English site

CDS : ACT4_013_00690

CDS Description

CDSACT4_013_00690
Product nameFMN-dependent NADH-azoreductase
Gene nameazoR
ContigACT4013
location68335..68931
NBRC No.100985
MicrobeAcinetobacter sp.
Current statusHigh-Quality Draft
>ACT4_013_00690 FMN-dependent NADH-azoreductase
MTKVLVLKSSMMGEQSQTNQLIEQLLKQRAEHGFQDDVITHDLTTLNLPVLNADIFHALR
GAENDSQQIQKIVQLSDQLIAELKQADLLLIGAPMYNLNVPTQLKNWFDLVVRARHTFRY
TETYPQGLVDGVNAIVVSSRGGVHLGQPTDAVSPYLTSVLGLIGIHNVEFVYAEGMDIPP
LRENALKAAHTQILKLAV


>ACT4_013_00690 FMN-dependent NADH-azoreductase
ATGACAAAGGTGTTAGTACTTAAATCAAGCATGATGGGTGAGCAATCTCAGACGAATCAG
CTCATTGAGCAGCTTTTAAAGCAAAGAGCTGAACATGGCTTTCAAGATGATGTGATTACA
CATGACTTAACAACGCTGAATTTACCTGTATTAAATGCTGATATTTTTCATGCGCTACGT
GGTGCCGAAAATGATTCACAGCAAATCCAAAAGATTGTGCAATTGTCTGATCAATTGATT
GCAGAATTAAAGCAGGCTGACTTGTTGTTGATCGGTGCGCCGATGTATAACTTGAATGTA
CCCACGCAATTGAAAAACTGGTTTGATTTGGTTGTACGTGCACGTCATACCTTCAGATAT
ACCGAAACTTATCCGCAAGGGTTGGTAGACGGCGTAAATGCAATTGTGGTCAGTAGCCGT
GGCGGAGTACATTTAGGACAGCCGACAGATGCTGTAAGTCCTTATTTAACATCAGTGTTA
GGTTTGATTGGTATTCATAATGTTGAGTTTGTTTATGCTGAGGGTATGGATATTCCACCA
TTACGTGAAAATGCTTTAAAAGCCGCACATACGCAGATACTAAAACTCGCAGTCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)