English site

CDS : Amir_1069

CDS Description

CDSAmir_1069
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP001630
location1186316..1186921
NBRC No.14064
MicrobeActinosynnema mirum
Current status
>Amir_1069 NAD(P)H dehydrogenase (quinone)
VLLHIDTSLRTEGSVSREVTAAFAEAWREAHPGAGYAYRDLGVDPLPHLDAAALASRMRG
EESPLARELGAELEAADTVLLGTPMYNFTITSSLKAWLDWVTQSSYMADRETGRGALSGK
RVVVVTARGGSYAPGTPREGFDFQEPYLKAAFSLIGLHHDLEFVHAEMTNANLVPDLAQF
KDLAATSLAEAHRNARTLAAA


>Amir_1069 NAD(P)H dehydrogenase (quinone)
GTGCTGCTGCACATCGACACGAGCCTGCGCACCGAGGGTTCGGTGTCCAGGGAGGTCACC
GCCGCGTTCGCCGAGGCCTGGCGGGAGGCCCACCCCGGCGCCGGGTACGCCTACCGCGAC
CTGGGCGTCGACCCGCTCCCGCACCTCGACGCGGCGGCGCTGGCCAGCCGGATGCGCGGC
GAGGAGAGCCCGCTGGCGCGCGAGCTGGGCGCCGAGCTGGAGGCGGCGGACACCGTGCTC
CTGGGCACCCCGATGTACAACTTCACGATCACGTCGTCGCTGAAGGCGTGGCTGGACTGG
GTGACCCAGAGCTCGTACATGGCCGACCGCGAGACGGGCAGGGGCGCGCTGAGCGGCAAG
CGCGTCGTCGTGGTGACCGCCAGAGGCGGCTCGTACGCGCCGGGCACCCCGAGGGAGGGC
TTCGACTTCCAGGAGCCGTACCTGAAGGCGGCCTTCAGCTTGATCGGCCTCCACCACGAC
CTGGAGTTCGTCCACGCCGAGATGACCAACGCCAACCTGGTCCCGGACCTGGCCCAGTTC
AAGGACCTGGCAGCCACGTCCCTGGCCGAGGCCCACCGCAACGCCCGCACCCTGGCAGCC
GCCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)