English site

CDS : B736_12630

CDS Description

CDSB736_12630
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigNZ_AMQV01000182
location97185..97772
NBRC No.15645
MicrobeVibrio vulnificus
Current status
>B736_12630 FMN-dependent NADH-azoreductase
MSRLLVLKSSILGDYSQSNKLVDEFINKFDQQDVVVRDLAQQPLPVLDFQVATALRASGD
LSEAQQAIVDLSDQLIAEIKHADTLIIAAPMYNFTVPTQLKNWIDLIARAGVTFTYTEQG
PKGLIEGKKAVVVTTRGGIHKDAASDIITPYLKTVLGFVGITEVEFVYAEALNMGEDFAS
KGLASASEHLAALTA


>B736_12630 FMN-dependent NADH-azoreductase
ATGTCTCGTTTACTGGTATTAAAATCAAGCATCCTTGGTGATTACTCTCAATCAAACAAA
CTGGTTGACGAGTTCATCAATAAATTCGACCAACAAGACGTTGTCGTTCGTGATCTGGCC
CAGCAACCATTGCCTGTTTTAGATTTCCAAGTGGCGACAGCATTGCGCGCAAGCGGTGAT
TTAAGTGAAGCGCAACAGGCTATTGTTGATCTTTCTGACCAACTGATTGCCGAAATCAAA
CACGCTGACACCTTAATTATTGCTGCCCCTATGTACAACTTCACCGTCCCGACCCAGCTT
AAAAACTGGATCGATTTGATTGCTCGTGCTGGCGTTACCTTCACTTATACCGAGCAAGGT
CCGAAAGGACTGATCGAAGGTAAGAAAGCGGTTGTTGTAACGACTCGTGGTGGTATTCAT
AAAGACGCAGCGAGTGACATCATCACTCCATACCTAAAAACCGTATTAGGGTTTGTTGGT
ATCACAGAGGTTGAATTTGTTTACGCTGAAGCACTCAACATGGGTGAAGACTTTGCCTCT
AAAGGCTTGGCTTCAGCAAGTGAGCACCTTGCTGCGCTAACCGCTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)