English site

CDS : BAMF_1030

CDS Description

CDSBAMF_1030
Product nameoxidoreductase, NAD(P)H-FMN and ferric iron reductase
Gene name
ContigFN597644
location1054701..1055225
NBRC No.15535
MicrobeBacillus amyloliquefaciens
Current status
>BAMF_1030 oxidoreductase, NAD(P)H-FMN and ferric iron reductase
MSILVISGTPRKNGRTRIAASYIRDRFHTDFIDLSESGLPLYNGEEEQNELPSVQELRRL
VKKSSAVVLLSPEYHSGMSGALKNAIDFLSSEHCTYKPVAIIAAAGGGKGGMNALANMRT
VMRGVYANVIPKQLILDPIHIDMERQTVSEDMAVSLKDMMEELNMFINTGNPGV


>BAMF_1030 oxidoreductase, NAD(P)H-FMN and ferric iron reductase
ATGAGCATATTAGTGATCAGCGGCACCCCGAGAAAAAACGGGCGGACTAGAATTGCCGCT
TCTTATATCAGAGACCGGTTTCATACCGATTTTATTGATTTGAGCGAAAGCGGACTGCCG
CTATATAACGGTGAAGAAGAACAGAATGAATTGCCCTCAGTGCAAGAGCTGAGACGGCTT
GTGAAAAAGTCGTCTGCCGTCGTCTTATTATCTCCCGAGTATCACAGCGGCATGAGCGGC
GCGTTAAAAAACGCCATTGATTTTTTAAGCAGCGAACACTGTACCTATAAACCGGTGGCA
ATCATTGCCGCGGCGGGCGGAGGAAAAGGCGGCATGAACGCGCTGGCGAATATGCGGACA
GTCATGCGGGGCGTCTATGCAAATGTTATCCCGAAACAGCTGATTTTAGATCCGATTCAC
ATTGACATGGAGCGCCAGACCGTATCTGAGGATATGGCGGTCAGCCTGAAAGACATGATG
GAAGAACTGAACATGTTTATAAACACAGGAAATCCCGGCGTTTAA


Assigned Rule

Assigned RuleRelated Function
AZR (NRULE_0237)NADPH azoreductaseAromatic azo compounds degradation (NFUNC_0073)