English site

CDS : BAMF_3202

CDS Description

CDSBAMF_3202
Product nameazoreductase
Gene name
ContigFN597644
location3260782..3261450
NBRC No.15535
MicrobeBacillus amyloliquefaciens
Current status
>BAMF_3202 azoreductase
VCNLKTKGLFTMAKVLYITAHPHDEKTSYSMATGKAFIDSYKESNPNDEVVHIDLYKENI
PHIDADVFSGWGKLQSGTGFEELSENEKAKVGRLNELSDQFASADKYVFVTPLWNFSFPP
VMKAYLDSVAVAGKSFKYTEQGPIGLLTDKKALHIQARGGYYSEGPAADMEMGHRYIGIM
MNFFGVPSFDGLIVEGHNAEPNKAQQIKEDAIARAKEAGKSF


>BAMF_3202 azoreductase
GTGTGTAATCTGAAAACGAAAGGGCTGTTTACAATGGCAAAAGTACTTTATATCACTGCT
CATCCTCATGATGAAAAGACATCTTACAGCATGGCGACAGGAAAAGCGTTTATCGATTCT
TATAAAGAATCAAACCCGAATGATGAGGTTGTACATATCGACCTTTACAAAGAAAACATT
CCTCATATCGACGCGGATGTATTCAGCGGCTGGGGAAAACTTCAATCCGGCACAGGTTTT
GAAGAGCTTTCTGAAAATGAAAAAGCGAAAGTCGGCCGTCTGAACGAGCTGAGCGATCAA
TTCGCATCTGCTGACAAATACGTATTCGTTACACCGCTTTGGAACTTCTCATTCCCGCCT
GTTATGAAAGCGTACCTTGATTCTGTAGCTGTAGCCGGAAAATCATTCAAATATACAGAA
CAAGGCCCGATCGGTCTGTTGACAGACAAAAAAGCGCTCCACATTCAGGCGCGCGGAGGC
TATTACTCTGAAGGCCCGGCGGCTGACATGGAAATGGGCCACCGTTACATCGGCATCATG
ATGAACTTCTTCGGCGTTCCTTCTTTTGACGGTTTAATCGTTGAAGGCCATAATGCTGAA
CCGAATAAAGCACAGCAAATTAAAGAAGATGCGATTGCCCGCGCGAAAGAAGCCGGAAAA
TCATTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)