English site

CDS : BATRMS_04_00070

CDS Description

CDSBATRMS_04_00070
Product namebeta-lactamase
Gene name
ContigAEFM01000004
location7175..7981
NBRC No.13721
MicrobeBacillus atrophaeus
Current status
>BATRMS_04_00070 beta-lactamase
MKKRKMPAVFLALIGAAGLLFTTSVQPISEASAAEKNLNIKKLDVDEFFADHNGTFILRD
MNKGKTFIYNHERANQRFAPQSTFKVPNALIGLQVGAVEDEYSIKYWDGVKREIDIWNQD
HTLGSGMRHSVVWYYQAMARDIGESRMKEWIEKISYGNQDISGGIDQFWLSSTLKISPIE
QADFMERLYKENLPFDKDVMKTVKRMMIQEEEDHSTLYGKTGSGTGIGWFFGFVKIDNRA
YSFVTNIDGTGAEAKNITMDILKKYKLY


>BATRMS_04_00070 beta-lactamase
ATGAAAAAACGCAAGATGCCAGCAGTTTTCTTAGCATTGATCGGTGCAGCCGGTCTATTA
TTTACTACAAGTGTACAGCCAATAAGCGAAGCTAGTGCTGCCGAAAAGAATCTGAATATC
AAAAAGCTCGATGTCGATGAATTTTTTGCCGATCATAACGGAACGTTTATATTACGTGAT
ATGAATAAAGGCAAAACATTTATCTATAATCATGAACGCGCCAACCAAAGATTTGCACCG
CAATCGACTTTTAAAGTTCCTAATGCACTCATTGGCTTACAAGTAGGAGCTGTAGAAGAT
GAATATTCCATTAAATATTGGGATGGCGTGAAGCGGGAAATTGACATCTGGAATCAAGAT
CACACGCTTGGGTCTGGGATGAGGCATTCAGTTGTTTGGTATTATCAAGCGATGGCCCGT
GACATTGGAGAAAGTCGAATGAAGGAATGGATCGAAAAAATTTCCTATGGCAACCAAGAT
ATAAGCGGTGGAATTGACCAGTTTTGGTTAAGCAGCACACTCAAAATTTCTCCGATAGAA
CAAGCAGACTTTATGGAAAGATTGTATAAAGAGAACCTGCCTTTTGATAAGGATGTCATG
AAAACAGTAAAACGGATGATGATTCAGGAGGAAGAAGATCACTCTACTCTTTACGGAAAA
ACAGGTTCAGGGACAGGCATAGGGTGGTTTTTCGGTTTTGTGAAAATAGACAATCGAGCG
TATAGTTTTGTTACGAATATTGATGGAACAGGTGCAGAAGCTAAAAACATCACAATGGAT
ATTTTAAAGAAATATAAGTTATATTAA


Assigned Rule

Assigned RuleRelated Function
BLAD (NRULE_0125)Beta-lactamase class DAmpicillin resistance (NFUNC_0046)
Beta-lactam antibiotic resistance (NFUNC_0033)
Penicillin resistance (NFUNC_0047)