English site

CDS : BATRMS_05_00800

CDS Description

CDSBATRMS_05_00800
Product namebiotin synthase
Gene namebioB
ContigAEFM01000005
location79281..80288
NBRC No.13721
MicrobeBacillus atrophaeus
Current status
>BATRMS_05_00800 biotin synthase
MNQWVDLADRVLDGAEVTNEEALSILECPDEEILLLMHAAFQIRKRFYGKKVKLNMIMNA
KSGLCPENCGYCSQSSISKAPIDAYRMVKKDTLLEGAKRAHDLNIGTYCIVASGRGPSNR
EVDQVVEAVQEIKGTYGLKVCACLGLLKPEQAQRLKEAGVDRYNHNLNTSQSNHANITTS
HTYDDRVNTVEIAKESGMSPCSGVIIGMKETKQDVIDIAKSLKALDADSIPVNFLHAIDG
TPLEGVNELNPLYCLKVLALFRFINPSKEIRISGGREVNLRSLQPLGLYAANSIFVGDYL
TTAGQEETEDHKMLLDLGFEVESVQEMKASLEAKS


>BATRMS_05_00800 biotin synthase
ATGAATCAATGGGTGGACCTTGCAGACCGAGTGTTAGATGGAGCGGAAGTAACAAACGAA
GAGGCTCTTTCAATCTTAGAATGTCCAGATGAGGAAATTCTGCTGCTGATGCATGCTGCT
TTTCAGATCAGAAAACGCTTTTACGGAAAAAAAGTAAAGCTTAATATGATTATGAATGCG
AAGTCCGGACTGTGCCCGGAAAATTGCGGATATTGTTCTCAGTCTTCCATTTCGAAAGCG
CCGATTGATGCTTATCGGATGGTAAAGAAAGATACCCTTCTAGAGGGCGCAAAGCGTGCA
CATGATTTAAATATAGGAACATATTGTATTGTTGCCAGCGGCAGGGGACCGTCTAATAGA
GAAGTTGATCAGGTTGTTGAAGCGGTGCAGGAAATTAAAGGTACGTACGGATTGAAAGTT
TGTGCATGTCTCGGGCTGTTAAAACCGGAGCAGGCGCAACGTCTCAAAGAAGCGGGAGTA
GACCGCTATAATCATAATTTGAATACATCACAGAGCAACCATGCCAACATTACCACTTCA
CATACGTACGATGACAGGGTTAATACAGTGGAAATAGCAAAAGAATCTGGTATGTCTCCT
TGCTCAGGTGTCATTATCGGGATGAAGGAGACGAAACAGGATGTTATCGATATTGCAAAA
AGCTTGAAAGCTCTTGACGCGGATTCAATACCGGTCAATTTCTTGCATGCGATTGACGGC
ACACCCTTAGAAGGCGTAAATGAATTAAACCCGCTGTATTGTTTAAAAGTACTCGCTCTA
TTCCGTTTTATCAATCCGTCAAAGGAAATCCGCATTTCAGGAGGACGGGAAGTCAACCTG
CGTTCATTACAGCCATTAGGGTTATATGCAGCCAACTCCATATTCGTCGGAGATTATCTA
ACAACGGCTGGGCAAGAAGAAACGGAAGATCATAAAATGCTGCTTGATTTAGGATTTGAA
GTAGAGTCGGTACAAGAAATGAAAGCCAGCCTGGAAGCGAAGAGTTAA


Assigned Rule

Assigned RuleRelated Function
BIOB (NRULE_0185)Biotin synthaseBiotin biosynthesis (NFUNC_0051)