English site

CDS : BATRMS_10_08510

CDS Description

CDSBATRMS_10_08510
Product nameNADPH-dependent FMN reductase YhdA
Gene nameazr
ContigAEFM01000010
location878723..879247
NBRC No.13721
MicrobeBacillus atrophaeus
Current status
>BATRMS_10_08510 NADPH-dependent FMN reductase YhdA
LNILVINGTARKQGRTRIAASYISALYNTGLIDLSEYILPIFNGEAEQFEIERVQQLKQR
VKEADAVVLLSPEYHSGMSGALKNAIDFLSNEQFKYKPVALLAVAGGGKGGINALTNMRT
VMRGVYANVIPKQLVLDPVHIDYDNAAVTEEMEVSIKELMEELKMFAKAGNPGI


>BATRMS_10_08510 NADPH-dependent FMN reductase YhdA
TTGAATATATTAGTGATTAACGGAACTGCAAGAAAACAGGGCAGAACAAGAATTGCCGCT
TCATATATCTCAGCTTTATACAACACCGGGTTGATTGACTTAAGCGAATACATATTGCCG
ATTTTTAATGGGGAAGCAGAGCAGTTTGAAATTGAGCGTGTTCAGCAGCTTAAACAGCGT
GTAAAAGAGGCCGATGCGGTTGTTTTATTATCGCCTGAATATCATAGCGGCATGAGCGGA
GCATTAAAAAATGCGATAGACTTCCTGAGCAATGAACAATTTAAATATAAGCCTGTGGCA
TTATTGGCAGTGGCAGGAGGCGGAAAAGGCGGTATCAATGCTTTGACGAATATGCGCACA
GTCATGCGCGGAGTATACGCCAACGTCATTCCGAAGCAGCTTGTGCTTGATCCCGTCCAT
ATTGATTATGATAATGCCGCGGTAACAGAAGAAATGGAAGTCAGTATAAAAGAATTAATG
GAAGAACTGAAAATGTTCGCAAAAGCAGGAAATCCCGGCATCTGA


Assigned Rule

Assigned RuleRelated Function
AZR (NRULE_0237)NADPH azoreductaseAromatic azo compounds degradation (NFUNC_0073)