English site

CDS : BATRMS_15_00210

CDS Description

CDSBATRMS_15_00210
Product nameazoreductase
Gene nameyvaB
ContigAEFM01000015
location19490..20125
NBRC No.13721
MicrobeBacillus atrophaeus
Current status
>BATRMS_15_00210 azoreductase
MAKVLYITAHPHDEATSYSMATGKAFIESYKEANPNDEVVHIDLYKENIPHIDADVFSGW
GKLQSGSGFEELPENEKAKVGRLAELSDQFAAADKYVFVTPLWNFSFPPVMKAYLDSVAV
AGKSFRYTEQGPVGLLTDKKALHIQARGGYYSEGPAADMEMGHRYIGIMMNFFGVPSFDG
LIVEGHNAEPDKAQQIKEDAIARAKEAGKTF


>BATRMS_15_00210 azoreductase
ATGGCAAAAGTACTTTATATCACCGCTCATCCGCATGATGAAGCAACATCATACAGCATG
GCAACAGGTAAAGCATTTATCGAGTCTTATAAAGAAGCGAATCCGAATGATGAGGTTGTA
CATATTGACCTGTACAAAGAAAACATTCCTCATATTGATGCTGATGTATTCAGCGGATGG
GGCAAGCTTCAATCAGGTTCAGGCTTTGAAGAGCTTCCGGAGAACGAAAAAGCGAAAGTC
GGACGTCTTGCGGAACTTAGCGATCAATTTGCCGCAGCTGATAAATACGTGTTTGTAACA
CCGTTATGGAACTTCTCATTCCCGCCGGTTATGAAAGCGTACCTTGATTCAGTCGCAGTA
GCAGGCAAATCATTTAGATACACAGAACAAGGTCCGGTCGGTTTATTAACTGATAAAAAA
GCGCTCCACATTCAAGCACGCGGAGGCTATTATTCAGAAGGCCCTGCGGCTGACATGGAA
ATGGGCCATCGCTACATCGGCATCATGATGAACTTCTTCGGCGTTCCTTCTTTTGACGGC
TTGATTGTCGAAGGTCATAATGCTGAGCCTGATAAAGCGCAGCAAATCAAAGAAGATGCA
ATCGCCCGCGCGAAAGAAGCAGGTAAAACATTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)