English site

CDS : BATRMS_17_02750

CDS Description

CDSBATRMS_17_02750
Product name6,7-dimethyl-8-ribityllumazine synthase
Gene nameribH
ContigAEFM01000017
location246432..246896
NBRC No.13721
MicrobeBacillus atrophaeus
Current status
>BATRMS_17_02750 6,7-dimethyl-8-ribityllumazine synthase
MNIIQGNLVGTGLKIGIVVGRFNDFITSKLLSGAEDTLLRHGVDTNDIDVAWVPGAFEIP
FAAKKMAETKKYDAIITLGTVIRGATTHYDYVCNEAAKGIAQAGNTTGVPVIFGIVTTET
IEQAIERAGTKAGNKGSDCAVSAIEMANLNRSFE


>BATRMS_17_02750 6,7-dimethyl-8-ribityllumazine synthase
ATGAATATTATACAAGGAAATTTAGTTGGCACAGGTCTTAAAATCGGAATCGTCGTAGGA
AGATTTAATGATTTTATCACAAGCAAGCTGTTAAGCGGTGCGGAGGACACTTTACTGAGA
CACGGAGTAGATACAAATGATATCGATGTGGCTTGGGTGCCGGGTGCATTTGAAATTCCG
TTTGCAGCAAAAAAAATGGCGGAAACAAAAAAATACGATGCGATTATCACACTCGGAACC
GTTATCCGGGGCGCTACGACTCATTATGATTATGTTTGCAACGAAGCCGCCAAAGGCATC
GCGCAAGCAGGAAATACAACAGGAGTGCCGGTCATTTTTGGAATTGTCACTACGGAGACC
ATTGAGCAGGCGATTGAACGCGCTGGCACAAAAGCAGGGAATAAAGGTTCTGATTGCGCC
GTATCTGCCATAGAAATGGCAAATTTAAACCGCTCATTTGAATAA


Assigned Rule

Assigned RuleRelated Function
RIBH (NRULE_0203)6,7-dimethyl-8-ribityllumazine synthaseRiboflavin biosynthesis (NFUNC_0058)