English site

CDS : BAT_0365

CDS Description

CDSBAT_0365
Product namefmn-dependent NADH-azoreductase 1 (fmn-dependent nadh-azocompound oxidoreductase 1) (azo-dye reductase 1)
Gene name
ContigABRX01000002
location291480..292130
NBRC No.12092
MicrobeBacillus pumilus
Current status
>BAT_0365 fmn-dependent NADH-azoreductase 1 (fmn-dependent nadh-azocompound oxidoreductase 1) (azo-dye reductase 1)
MQTLIINAHPDFTHRESYSNKLQTLFLEQFKERYPHDEPTILHLHETEIPRIEKDQLLRI
WNKQASEQTLTATEENIAAASSALLAQFKAHHRIVIVSPVHNFNVTSRMKDYIDNIFIAR
ETFKYTENGSVGLMTDDYRVLLLQASGSIFTNNDRYTPLEFSHYYLKEIFQNLMGFQQFH
IVRAQGTAILEEETILTSATDDLSKAFDAFYQPSGM


>BAT_0365 fmn-dependent NADH-azoreductase 1 (fmn-dependent nadh-azocompound oxidoreductase 1) (azo-dye reductase 1)
ATGCAAACATTAATCATTAACGCGCACCCTGATTTCACTCATCGAGAAAGTTATTCAAAC
AAACTGCAAACACTATTTTTAGAACAGTTTAAAGAAAGATACCCTCATGATGAACCAACC
ATTTTACATTTACATGAAACTGAAATTCCTCGTATCGAAAAAGACCAGCTGTTACGTATT
TGGAATAAGCAAGCATCTGAACAAACATTAACAGCTACCGAAGAAAACATCGCTGCTGCT
TCATCTGCTTTATTGGCTCAATTCAAAGCACATCATCGAATCGTCATTGTGTCACCTGTT
CATAATTTCAATGTGACGTCACGTATGAAAGATTATATAGATAATATTTTTATTGCGAGA
GAAACGTTTAAATATACAGAAAATGGTTCAGTTGGTCTGATGACTGACGATTATCGTGTA
CTTTTGCTTCAAGCAAGTGGCTCAATTTTCACAAATAACGATCGATACACACCTCTGGAA
TTTTCACATTACTACCTAAAAGAAATATTCCAAAACTTGATGGGCTTTCAACAATTTCAT
ATTGTCCGAGCACAAGGAACAGCGATTTTAGAGGAAGAAACGATCTTGACATCTGCAACT
GACGATTTGTCTAAAGCCTTTGATGCGTTTTACCAGCCTAGCGGGATGTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)