English site

CDS : BAT_3700

CDS Description

CDSBAT_3700
Product namefmn-dependent NADH-azoreductase 2 (fmn-dependent nadh-azocompound oxidoreductase 2) (azo-dye reductase 2)
Gene name
ContigABRX01000003
location345006..345641
NBRC No.12092
MicrobeBacillus pumilus
Current status
>BAT_3700 fmn-dependent NADH-azoreductase 2 (fmn-dependent nadh-azocompound oxidoreductase 2) (azo-dye reductase 2)
MAKVLYITAHPHDETVSYSMATAKAFIESYKEANPSDEVVHIDLYKENIPHIDADVFAGW
GKLQSGAGFDTLSAEEQAKVARLNELSDQFVSADKYVFVSPLWNFSFPPVLKAYIDSVAV
AGKTFKYTEQGPVGLLTDKKALHIQARGGYYTEGPAAELEAGHRYLGTIASFFGIPSFEG
LIVEGHNAEPAKAEQIKADAIERAKALGKTF


>BAT_3700 fmn-dependent NADH-azoreductase 2 (fmn-dependent nadh-azocompound oxidoreductase 2) (azo-dye reductase 2)
ATGGCAAAAGTTTTATACATCACTGCACATCCGCATGATGAAACAGTTTCTTACAGTATG
GCTACTGCTAAAGCATTTATCGAATCTTATAAGGAAGCAAACCCAAGTGACGAGGTTGTA
CATATCGATTTGTACAAAGAAAACATCCCTCACATTGATGCAGATGTATTCGCTGGCTGG
GGCAAGCTGCAATCAGGTGCTGGTTTCGATACACTTTCAGCTGAAGAGCAAGCGAAGGTT
GCTCGCCTAAACGAATTAAGCGATCAATTCGTTTCTGCTGACAAATATGTATTTGTTTCA
CCACTTTGGAACTTCTCATTCCCACCAGTTCTTAAAGCATACATCGACTCTGTTGCTGTA
GCTGGTAAAACATTCAAATACACGGAGCAAGGTCCTGTTGGATTATTAACAGACAAAAAA
GCTCTACACATCCAAGCACGTGGCGGATACTACACTGAAGGTCCTGCTGCTGAACTTGAA
GCAGGCCACCGTTACCTTGGTACAATTGCGAGCTTCTTCGGAATTCCTTCTTTCGAAGGT
CTTATCGTTGAAGGTCACAATGCTGAACCTGCGAAAGCAGAGCAAATTAAAGCAGATGCA
ATCGAACGTGCAAAAGCTTTAGGTAAAACTTTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)