English site

CDS : BC_2229

CDS Description

CDSBC_2229
Product nameAzoreductase
Gene name
ContigAE016877
location2175354..2175890
NBRC No.15305
MicrobeBacillus cereus
Current status
>BC_2229 Azoreductase
MKLVVINGTPRKFGRTRVVAKYIADQFEGELYDLAIEELPLYNGEESQRDLEAVKKLKTL
VKAADGVVLCTPEYHNAMSGALKNSLDYLSSSEFIHKPVALLAVAGGGKGGINALNSMRT
VARGVYANAIPKQVVLDGLHVQDGELGEDAKPLIHDVVKELKAYMSVYKEVKKQLGVE


>BC_2229 Azoreductase
ATGAAACTAGTCGTTATTAACGGTACACCAAGAAAATTTGGTCGAACTCGTGTGGTGGCA
AAATATATTGCGGATCAATTTGAAGGGGAATTATATGATTTAGCAATTGAGGAGTTACCT
TTATACAATGGAGAAGAGTCACAACGTGATTTAGAGGCAGTAAAAAAATTAAAAACGTTA
GTGAAAGCTGCGGATGGGGTTGTATTATGTACACCAGAATATCATAATGCGATGAGCGGT
GCGCTGAAAAACTCTTTAGATTACTTAAGTAGTAGTGAATTTATTCATAAACCAGTTGCA
TTGTTAGCGGTTGCTGGTGGCGGTAAAGGTGGAATAAATGCATTAAACAGCATGCGAACG
GTCGCTAGAGGTGTTTATGCAAATGCAATTCCAAAACAAGTTGTGCTTGATGGATTACAT
GTGCAAGATGGTGAACTTGGAGAAGATGCAAAACCATTAATTCATGATGTAGTTAAAGAA
TTAAAAGCATATATGAGCGTATATAAAGAGGTGAAAAAACAACTAGGAGTGGAATGA


Assigned Rule

Assigned RuleRelated Function
AZR (NRULE_0237)NADPH azoreductaseAromatic azo compounds degradation (NFUNC_0073)