English site

CDS : BC_5410

CDS Description

CDSBC_5410
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigAE016877
location5325069..5325695
NBRC No.15305
MicrobeBacillus cereus
Current status
>BC_5410 FMN-dependent NADH-azoreductase
MATVLFVKANNRPAEQAVSVKLYEAFLANYKEANPNDTVVELDLYKEELPYVGVDMINGT
FKVGKGFDLTEEEAKAVAVADKYLNQFLEADKVVFGFPLWNLTIPAVLHTYIDYLNRAGK
TFKYTPEGPVGLIGDKKIALLNARGGVYSEGPAAEVEMAVKYVASMMGFFGATNMETVVI
EGHNQFPDKAEEIIAAGLEEAAKVASKF


>BC_5410 FMN-dependent NADH-azoreductase
ATGGCAACAGTTTTATTCGTTAAAGCAAATAACCGTCCAGCGGAACAAGCAGTTAGTGTA
AAATTATATGAGGCATTTTTAGCAAACTATAAAGAAGCAAACCCAAATGATACAGTAGTA
GAACTTGATTTATATAAAGAAGAATTACCATACGTAGGCGTAGACATGATCAATGGTACA
TTCAAGGTAGGTAAAGGATTTGATTTAACAGAAGAAGAAGCAAAAGCAGTAGCAGTTGCT
GATAAGTATTTAAATCAATTCCTAGAAGCTGATAAAGTTGTTTTCGGCTTCCCATTATGG
AACTTAACGATTCCAGCAGTATTGCACACATATATTGATTATTTAAACCGTGCTGGTAAA
ACGTTCAAATATACGCCAGAGGGTCCAGTTGGCCTAATCGGAGATAAGAAGATTGCATTA
TTAAATGCACGAGGCGGCGTATATTCAGAAGGGCCAGCAGCTGAGGTAGAAATGGCTGTT
AAATATGTAGCAAGTATGATGGGCTTCTTCGGCGCAACAAACATGGAAACAGTAGTTATT
GAAGGGCATAACCAATTCCCAGATAAAGCAGAAGAAATCATCGCTGCAGGTCTTGAAGAA
GCAGCTAAAGTAGCAAGTAAATTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)