English site

CDS : BL00833

CDS Description

CDSBL00833
Product nameputative NAD(P)H dehydrogenase YvaB
Gene nameyvaB
ContigCP000002
location3417480..3418115
NBRC No.12200
MicrobeBacillus licheniformis
Current status
>BL00833 putative NAD(P)H dehydrogenase YvaB
MTKTLYITAHPHDERASYSMAAGKAFIESYKEAHPDDEVIHLDLYRENIPQIDADVFSGW
GKLQSGSGFEQLSEHEKAKVGRLNELSEQFIAGDKYVFVTPLWNFSFPPVMKAYFDAVAV
AGKTFKYTEQGPIGLLTDKKALHIQARGGYYSEGQAAELEMGHRYISIMMQFFGVPEFEG
LFIEGHNAEPDKAEEIKQNAIVRAKELGRTF


>BL00833 putative NAD(P)H dehydrogenase YvaB
ATGACAAAAACCCTTTACATTACCGCTCACCCGCATGACGAAAGGGCATCCTACAGCATG
GCGGCAGGAAAAGCGTTTATCGAATCTTACAAAGAAGCTCATCCGGATGACGAAGTCATA
CACCTTGATCTTTATCGGGAAAACATTCCGCAGATTGATGCGGATGTTTTCAGCGGCTGG
GGAAAATTGCAGTCGGGGTCGGGCTTTGAACAGCTTTCTGAACACGAAAAAGCTAAAGTC
GGCCGTTTGAATGAGCTGAGCGAGCAATTTATCGCGGGAGACAAATACGTGTTTGTCACG
CCGCTTTGGAATTTCTCTTTTCCGCCGGTGATGAAAGCGTACTTCGATGCGGTCGCTGTA
GCGGGAAAGACGTTTAAATATACCGAACAGGGACCGATCGGGCTGTTAACCGATAAAAAA
GCGCTGCACATCCAGGCGAGAGGCGGCTACTATTCAGAAGGGCAGGCTGCGGAACTTGAG
ATGGGGCACCGCTATATCAGCATCATGATGCAGTTTTTCGGGGTTCCGGAATTTGAAGGT
TTATTTATAGAAGGGCATAATGCTGAGCCTGATAAAGCTGAAGAAATAAAACAAAATGCG
ATTGTCCGAGCCAAAGAATTGGGCAGGACTTTTTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)