English site

CDS : BL02896

CDS Description

CDSBL02896
Product nameputative NADPH-dependent FMN reductase YhdA
Gene nameazr
ContigCP000002
location1005496..1006014
NBRC No.12200
MicrobeBacillus licheniformis
Current status
>BL02896 putative NADPH-dependent FMN reductase YhdA
MKITVISGTARKQGRTRIAASYIARAYQAELIDLSEFILPIFNGDEEQSSLENVQKLKAS
VKEADAVVLLSPEYHSGMSGALKNALDFLSNEQFSGKPVALFACAGGGKGGMNALANMRI
VARGVYANVITKQLVLDPIHIDEEHQTVTEAAKANIKNVMEELLLFAEFQKA


>BL02896 putative NADPH-dependent FMN reductase YhdA
ATGAAAATAACCGTAATTAGCGGAACTGCGAGAAAACAGGGCAGAACGCGGATCGCCGCT
TCCTATATCGCCCGCGCTTATCAGGCTGAGCTTATCGATCTAAGCGAGTTCATCCTTCCG
ATTTTCAACGGAGACGAAGAGCAAAGCTCGCTGGAGAATGTTCAAAAATTGAAAGCTTCG
GTCAAAGAAGCAGACGCTGTCGTTTTATTATCTCCCGAATACCACAGCGGTATGAGCGGC
GCTTTGAAAAATGCACTCGATTTTTTAAGCAATGAGCAGTTCTCGGGCAAACCGGTGGCG
CTTTTTGCTTGTGCAGGGGGCGGCAAAGGCGGGATGAACGCGCTCGCCAATATGCGCATT
GTCGCACGCGGAGTTTATGCGAACGTCATCACAAAGCAGCTTGTGCTCGATCCGATTCAT
ATTGATGAGGAGCACCAAACGGTTACTGAAGCAGCCAAAGCCAATATTAAAAATGTAATG
GAAGAGCTTCTGCTCTTTGCCGAATTTCAAAAAGCCTGA


Assigned Rule

Assigned RuleRelated Function
AZR (NRULE_0237)NADPH azoreductaseAromatic azo compounds degradation (NFUNC_0073)