English site

CDS : BN6_12620

CDS Description

CDSBN6_12620
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigHE804045
location1318868..1319479
NBRC No.15066
MicrobeSaccharothrix espanaensis
Current status
>BN6_12620 NAD(P)H dehydrogenase (quinone)
MTGLLHIDSSVRTEGSVSREVTAAFATAWREARPDVGYTYRDLAARPLPHVDGAAVEARQ
TTDRHRVEQELVAELTAADTVLIGAPMYNFSLPSGLKAWLDWILVPEHFANPETGVGALS
DKHFVIVTARGGSYAPGTPRHTDDYQEPYLRFIFERLGVRQTLEFVHTELTLAHTVPHLA
QFRDKADESREDAHRTVRKLALA


>BN6_12620 NAD(P)H dehydrogenase (quinone)
ATGACGGGTCTGCTCCACATCGACTCCAGCGTGCGCACCGAGGGCTCGGTCTCCAGGGAG
GTGACCGCCGCCTTCGCCACCGCGTGGCGGGAGGCGCGCCCGGACGTCGGCTACACCTAC
CGGGACCTGGCCGCCCGACCGCTCCCGCACGTGGACGGCGCGGCGGTCGAAGCCCGCCAG
ACCACCGACCGGCACCGCGTGGAACAGGAACTGGTGGCCGAGCTGACCGCCGCGGACACC
GTGCTGATCGGCGCGCCGATGTACAACTTCTCGCTGCCGTCGGGCCTGAAGGCCTGGCTG
GACTGGATCCTCGTGCCCGAGCACTTCGCGAACCCCGAGACCGGCGTCGGCGCGCTCTCC
GACAAGCACTTCGTGATCGTCACCGCCCGCGGCGGCTCGTACGCGCCCGGCACCCCGCGC
CACACCGACGACTACCAGGAGCCCTACCTGCGGTTCATCTTCGAGCGCTTGGGGGTGCGG
CAGACGTTGGAGTTCGTCCACACCGAACTGACCCTCGCGCACACCGTGCCGCACCTCGCG
CAGTTCCGGGACAAGGCCGACGAATCGCGCGAGGACGCCCACCGCACCGTCCGCAAGCTG
GCGCTCGCCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)