English site

CDS : BN6_62130

CDS Description

CDSBN6_62130
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigHE804045
location6939420..6940049
NBRC No.15066
MicrobeSaccharothrix espanaensis
Current status
>BN6_62130 NAD(P)H dehydrogenase (quinone)
MTKLLHVSASPRAEASESLVIASAFVDAYRESHPDDEVEHWDLWDGTLPAFGPAATAAKM
AVIRGDEPTGDEVAAWREVVAAAERFTSADRLLFSVPMWNSGIPYVLKQFVDVVSQPGMV
FGLDVETGYLPLLAGHGKRAAVVYTSSVWGPEVAPGFGSNFQSTYFDDWLRWTGITDLTT
IRHHPTLSGDAEDSRQTALATAREAAKTF


>BN6_62130 NAD(P)H dehydrogenase (quinone)
ATGACGAAGCTGCTGCACGTGTCCGCCTCGCCGCGAGCCGAGGCGTCGGAATCGCTGGTC
ATCGCATCGGCGTTCGTCGATGCCTACCGGGAGAGCCATCCCGACGACGAGGTCGAGCAC
TGGGACCTCTGGGACGGCACGCTGCCCGCGTTCGGGCCAGCCGCGACCGCCGCGAAGATG
GCGGTGATCCGGGGTGACGAGCCGACCGGCGACGAGGTGGCGGCCTGGCGCGAGGTGGTG
GCGGCGGCTGAGCGGTTCACCTCGGCCGACCGGCTGCTGTTCAGCGTGCCGATGTGGAAC
TCCGGGATCCCGTACGTGCTCAAGCAGTTCGTGGATGTCGTGTCCCAGCCGGGGATGGTG
TTCGGCCTCGACGTCGAGACCGGCTACTTGCCGCTGCTCGCGGGGCACGGCAAGCGGGCG
GCGGTCGTCTACACCAGCTCGGTGTGGGGGCCGGAGGTCGCACCGGGGTTCGGCTCGAAC
TTCCAGTCCACCTACTTCGACGACTGGCTCCGGTGGACGGGGATCACGGACCTGACCACG
ATCCGCCACCACCCGACCTTGAGCGGCGACGCCGAGGACTCGCGCCAGACCGCTCTCGCG
ACCGCCCGGGAGGCCGCCAAGACCTTCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)