English site

CDS : BSU09340

CDS Description

CDSBSU09340
Product nameoxidoreductase, NAD(P)H-FMN and ferric iron reductase
Gene name
ContigAL009126
location1010445..1010969
NBRC No.13719
MicrobeBacillus subtilis subsp. subtilis
Current status
>BSU09340 oxidoreductase, NAD(P)H-FMN and ferric iron reductase
MNMLVINGTPRKHGRTRIAASYIAALYHTDLIDLSEFVLPVFNGEAEQSELLKVQELKQR
VTKADAIVLLSPEYHSGMSGALKNALDFLSSEQFKYKPVALLAVAGGGKGGINALNNMRT
VMRGVYANVIPKQLVLDPVHIDVENATVAENIKESIKELVEELSMFAKAGNPGV


>BSU09340 oxidoreductase, NAD(P)H-FMN and ferric iron reductase
ATGAACATGTTAGTCATAAATGGCACGCCAAGAAAACATGGCAGAACAAGAATTGCAGCA
TCCTATATTGCAGCTCTGTATCACACGGATTTGATTGATCTAAGCGAGTTTGTATTGCCC
GTTTTTAACGGTGAAGCGGAACAATCTGAACTGTTGAAAGTACAGGAGCTTAAGCAACGC
GTTACGAAAGCGGATGCGATTGTATTATTATCGCCTGAATATCACAGCGGCATGAGCGGC
GCTTTAAAAAATGCCTTGGATTTTCTAAGCAGCGAACAATTCAAATATAAGCCCGTTGCA
TTATTGGCAGTAGCGGGAGGCGGAAAAGGCGGCATCAATGCGCTGAACAATATGAGAACT
GTGATGCGGGGTGTCTACGCCAATGTCATTCCGAAGCAGCTGGTGCTTGATCCGGTGCAT
ATTGATGTTGAAAATGCTACAGTGGCTGAAAACATTAAGGAAAGCATAAAAGAGCTTGTC
GAAGAACTCAGCATGTTCGCAAAAGCAGGAAATCCCGGCGTCTAA


Assigned Rule

Assigned RuleRelated Function
AZR (NRULE_0237)NADPH azoreductaseAromatic azo compounds degradation (NFUNC_0073)