English site

CDS : BSU19230

CDS Description

CDSBSU19230
Product nameantitoxin of ribonuclease RttI
Gene name
ContigAL009126
location2096350..2096976
NBRC No.13719
MicrobeBacillus subtilis subsp. subtilis
Current status
>BSU19230 antitoxin of ribonuclease RttI
MSTVLFVKSSDRTAEEGVSTKLYEAFLAAYKENNPNDEVVELDLHKENLPYLGRDMINGT
FKAGQGMEMTEDEKKQAAIADKYLNQFVKADKVVFAFPLWNFTVPAVLHTYVDYLSRAGV
TFKYTQEGPVGLMGGKKVALLNARGGVYSEGPMAALEMSLNFMKTVLGFWGVQDLHTVVI
EGHNAAPDQAQEIVEKGLQEAKDLAAKF


>BSU19230 antitoxin of ribonuclease RttI
ATGTCTACAGTTTTATTTGTAAAATCAAGCGACCGTACAGCTGAAGAAGGCGTTTCAACT
AAACTTTACGAAGCTTTCTTAGCTGCTTATAAAGAAAACAACCCTAATGATGAAGTGGTT
GAATTAGATCTTCATAAGGAAAACCTTCCTTACCTTGGCAGAGATATGATTAACGGAACA
TTTAAAGCAGGTCAAGGAATGGAAATGACAGAAGATGAGAAAAAACAAGCAGCAATTGCT
GACAAATATCTGAACCAGTTTGTAAAAGCTGACAAAGTTGTTTTCGCATTCCCGCTTTGG
AACTTCACAGTGCCAGCAGTGCTTCATACTTATGTTGATTATCTGTCTCGCGCAGGCGTT
ACATTCAAATACACACAAGAAGGACCAGTCGGTTTAATGGGCGGCAAAAAAGTTGCGCTT
CTTAACGCTCGCGGCGGTGTCTACTCAGAAGGACCAATGGCTGCACTTGAAATGTCATTA
AACTTCATGAAAACAGTTCTTGGTTTCTGGGGTGTTCAAGACTTGCACACAGTTGTCATC
GAAGGACATAACGCAGCACCTGATCAAGCGCAAGAAATCGTTGAAAAAGGTTTACAAGAA
GCAAAAGATCTTGCTGCAAAATTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)