English site

CDS : BSU33540

CDS Description

CDSBSU33540
Product nameNADH:dichloroindophenol oxidoreductase
Gene name
ContigAL009126
location3445442..3446077
NBRC No.13719
MicrobeBacillus subtilis subsp. subtilis
Current status
>BSU33540 NADH:dichloroindophenol oxidoreductase
MAKVLYITAHPHDEATSYSMATGKAFIESYKEANPNDEVVHIDLYKENIPHIDADVFSGW
GKLQSGTGFEELSESEKAKVGRLGELSDQFASADKYVFVTPLWNFSFPPVMKAYLDSVAV
AGKSFKYTEQGPVGLLTDKKAIHIQARGGYYSEGPAAEMEMGHRYIGIMMNFFGVPSFDG
IFVEGHNAEPDKAQQIKEDAIARAKEAGKTF


>BSU33540 NADH:dichloroindophenol oxidoreductase
ATGGCAAAAGTATTATATATCACTGCTCATCCACATGACGAAGCAACTTCGTACAGTATG
GCAACAGGTAAAGCATTTATCGAATCTTACAAAGAAGCGAATCCAAATGATGAAGTTGTA
CATATCGATTTGTACAAAGAAAACATTCCGCACATTGACGCAGATGTATTTAGCGGATGG
GGAAAGCTTCAGTCAGGTACAGGCTTTGAAGAGCTTTCTGAAAGCGAAAAAGCGAAAGTA
GGCCGTTTGGGAGAGCTTAGCGATCAATTTGCATCAGCTGATAAGTACGTATTTGTTACT
CCTTTATGGAACTTCTCATTCCCGCCAGTGATGAAAGCGTATCTCGATTCTGTTGCTGTT
GCAGGAAAATCATTCAAATACACAGAACAAGGTCCTGTCGGCTTGTTAACTGATAAAAAA
GCAATTCATATCCAAGCGCGCGGCGGCTACTATTCAGAAGGCCCTGCGGCTGAGATGGAA
ATGGGGCACCGCTACATCGGCATCATGATGAACTTCTTCGGCGTACCATCATTCGATGGC
ATTTTCGTAGAGGGACATAATGCGGAGCCTGATAAAGCACAGCAAATCAAAGAAGACGCG
ATTGCGCGTGCGAAAGAAGCAGGAAAAACATTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)