English site

CDS : BvalD_010100008273

CDS Description

CDSBvalD_010100008273
Product nameoxidoreductase, NAD(P)H-FMN and ferric iron reductase
Gene name
ContigNZ_JH600242
location5586..6107
NBRC No.101236
MicrobeBacillus vallismortis
Current status
>BvalD_010100008273 oxidoreductase, NAD(P)H-FMN and ferric iron reductase
MNMLVINGSPRKHGRTRITASCISKLYHTDLIDLSGFILPIFNGEAEQLEHLQVQELKRR
VAQADAIVLLSPEYHSGMSGSLKNALDFLSSEQFKYKPVALLAVAGGGKGGINALNNMRT
VMRGVYANVIPKQLVVDPVDIDIEKAALTEPITNSIKELIQELSMFAKGNPGV


>BvalD_010100008273 oxidoreductase, NAD(P)H-FMN and ferric iron reductase
ATGAACATGTTAGTGATAAATGGCTCACCCAGAAAACATGGCAGAACAAGAATAACCGCA
TCTTGTATTTCTAAGCTGTATCACACGGACCTGATTGATCTAAGCGGGTTTATATTGCCG
ATTTTTAATGGTGAGGCGGAGCAATTAGAACATTTACAGGTACAGGAGCTAAAGCGGCGG
GTTGCCCAAGCGGACGCGATTGTCTTATTATCGCCTGAATATCACAGCGGAATGAGCGGT
TCTTTAAAAAATGCGTTGGATTTTCTAAGCAGCGAACAATTCAAATATAAGCCTGTTGCT
TTATTGGCAGTGGCGGGAGGCGGAAAAGGCGGCATTAACGCCCTGAACAATATGCGAACT
GTGATGCGGGGTGTTTACGCCAATGTGATTCCGAAGCAGCTTGTGGTTGATCCGGTGGAC
ATTGATATTGAAAAGGCTGCATTGACGGAACCTATAACGAACAGCATAAAAGAGCTCATC
CAAGAACTTAGCATGTTTGCAAAAGGAAATCCCGGCGTTTAA


Assigned Rule

Assigned RuleRelated Function
AZR (NRULE_0237)NADPH azoreductaseAromatic azo compounds degradation (NFUNC_0073)