English site

CDS : BvalD_010100019852

CDS Description

CDSBvalD_010100019852
Product nameazoreductase
Gene name
ContigNZ_JH600271
location9416..10042
NBRC No.101236
MicrobeBacillus vallismortis
Current status
>BvalD_010100019852 azoreductase
MSTVLFVKSSDRTAEEGVSTKLYEAFLAAYKENNPADEVVELDLHKENLPYLGRDMINGT
FKAGQGMDMTEEEKKQAAIADKYLNQFVKADKVVFAFPLWNFTVPAVLHTYVDYLSRAGV
TFKYTQEGPVGLMGDKKVALLNARGGIYSEGPMAALEMSLNFMKTVLGFWGVQDLHTVVI
EGHNAAPDQAQAIVEKGLQEAKDLAAKF


>BvalD_010100019852 azoreductase
ATGTCTACAGTATTATTTGTAAAATCAAGCGATCGTACAGCTGAAGAGGGCGTTTCAACT
AAACTTTACGAAGCTTTCTTAGCTGCTTATAAAGAAAACAACCCTGCTGATGAAGTGGTT
GAATTAGATCTTCATAAAGAAAACCTTCCTTACCTTGGAAGAGATATGATTAACGGAACG
TTTAAAGCAGGTCAAGGAATGGACATGACAGAAGAAGAGAAAAAACAAGCAGCAATCGCT
GACAAATATCTCAATCAGTTTGTAAAAGCTGACAAAGTTGTTTTCGCATTCCCGCTTTGG
AACTTCACAGTGCCGGCAGTGCTTCATACTTATGTTGATTACCTGTCTCGTGCAGGCGTT
ACATTCAAATACACACAAGAAGGGCCAGTTGGTTTAATGGGCGACAAAAAAGTTGCGCTT
CTTAACGCGCGCGGCGGCATTTACTCTGAAGGACCAATGGCTGCACTTGAAATGTCATTA
AACTTCATGAAAACAGTTCTTGGTTTCTGGGGCGTTCAAGACTTGCACACAGTTGTCATC
GAAGGACATAACGCAGCGCCTGATCAAGCGCAAGCAATTGTTGAAAAAGGATTACAAGAA
GCAAAAGATCTTGCTGCAAAATTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)