English site

CDS : C666_00305

CDS Description

CDSC666_00305
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigAMXE01000001
location70895..71494
NBRC No.102519
MicrobeThauera linaloolentis
Current status
>C666_00305 NAD(P)H dehydrogenase (quinone)
MNILQINGSARSEGANSTRVANGIVARLLAAEPQARVVLRDLARNPAPVIDEAALGALFT
PVEQRTPEQAARVAQSDALIAEVQAADVIVLGVPMYNFGISSQLKNWIDAIARAGVTFRY
TENGPEGLLKGKKALVAFARGGRYRGTPADTQTPYLQAVLGFVGITDVRFVYAEGLNMGE
EAVQQGFAQAEADIEAVLG


>C666_00305 NAD(P)H dehydrogenase (quinone)
ATGAACATTCTGCAGATCAACGGCAGCGCCCGCAGCGAAGGCGCCAATTCCACCCGTGTC
GCCAACGGCATCGTCGCCCGCCTGCTGGCGGCCGAGCCCCAGGCCCGCGTCGTGCTGCGC
GATCTGGCACGCAACCCCGCCCCGGTGATCGATGAGGCTGCGCTGGGCGCCTTGTTCACG
CCGGTCGAGCAACGCACGCCGGAGCAGGCCGCCCGTGTCGCCCAGAGCGACGCGCTGATC
GCCGAAGTGCAGGCCGCCGACGTCATCGTGCTGGGCGTGCCGATGTACAACTTCGGCATT
TCGTCCCAGCTCAAGAACTGGATCGACGCCATCGCCCGTGCCGGCGTGACTTTCCGCTAC
ACCGAGAATGGTCCCGAAGGCCTGCTGAAAGGCAAGAAGGCGCTCGTTGCCTTCGCCCGC
GGTGGACGCTACCGTGGTACGCCGGCCGACACGCAGACCCCCTATCTCCAGGCCGTGCTC
GGCTTCGTCGGCATCACCGACGTCCGTTTCGTCTATGCCGAAGGCTTGAACATGGGTGAA
GAGGCGGTGCAGCAGGGCTTTGCCCAGGCCGAGGCCGACATCGAGGCCGTTCTCGGCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)