English site

CDS : C791_6695

CDS Description

CDSC791_6695
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigANMG01000065
location60853..61509
NBRC No.14573
MicrobeAmycolatopsis azurea
Current status
>C791_6695 FMN-dependent NADH-azoreductase
MSHLLHLDSSARSTSFSRELSARFAEVWRAAHPGAGYTYRDVAAAPVPPIGQAWTEICDA
LLTEGITDPAGYASVVRTPEQREAWTVVEPLLAELLAADVVLIGAPMYNFSIPATLKLWI
DQVTFPKMSLPGKAFVVAGARGGTYLPGTPREPVDHHERYLRDFFAGHYDVRDVTFLHSE
LTNALVDPRLSPRDPDRIASREEALLAVEKLAANGREA


>C791_6695 FMN-dependent NADH-azoreductase
ATGAGCCACCTTCTCCACCTCGACTCCAGTGCCCGCAGCACGTCGTTCTCCCGCGAGCTG
AGCGCTCGCTTCGCCGAGGTCTGGCGTGCCGCGCACCCCGGCGCGGGCTACACCTATCGC
GACGTCGCGGCCGCTCCGGTGCCGCCGATCGGCCAGGCCTGGACCGAGATCTGCGACGCC
CTCCTCACCGAGGGCATCACCGATCCGGCCGGGTACGCCTCGGTGGTGAGGACGCCGGAG
CAGCGCGAGGCGTGGACGGTCGTCGAGCCGCTGCTGGCCGAACTGCTCGCCGCCGACGTC
GTGCTGATCGGGGCGCCGATGTACAACTTCTCGATCCCCGCGACGCTCAAACTGTGGATC
GACCAGGTGACGTTCCCGAAGATGTCCTTGCCGGGCAAGGCTTTCGTGGTCGCGGGAGCG
CGCGGCGGCACCTACCTGCCGGGCACGCCCCGGGAGCCGGTCGATCATCACGAGCGCTAC
CTGCGTGACTTCTTCGCCGGGCACTACGACGTCCGCGACGTCACGTTCCTGCATTCCGAG
CTCACGAACGCCCTCGTCGACCCGCGGCTGAGCCCGCGCGACCCTGATCGGATCGCTTCG
CGCGAAGAGGCGCTTCTGGCGGTCGAAAAGCTGGCCGCGAACGGAAGGGAAGCCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)