English site

CDS : Caci_3591

CDS Description

CDSCaci_3591
Product nameesterase, PHB depolymerase family
Gene name
ContigCP001700
location4006511..4008067
NBRC No.102108
MicrobeCatenulispora acidiphila
Current status
>Caci_3591 esterase, PHB depolymerase family
MLRSRSVKTRLLGLFAAVAAAVAVSLPAAPQAAAASLTQVTNFGTNPSNLAMYVYVPNNV
KPNPSILLAMHGCQGTASYMYSSTDFGKLADQYGFIVIYPQTNPSGSCWDVSSDQALKRN
GGSDPVGLMSMITYTEQHYGGNANSVFVTGESSGGMMTNVMLADYPDVFKAGAAFMGVPY
HCFYTGSVRGWNSPCANGQVSMTAQQWGDLVRNDGDPGYTGPRPRMQLWHGTADTTLNYN
NLGEEIKQWTNVDGVSQTPSSSDTPVANWNRTRYNNASGTTQVEAYSIVGAGHQLPIQGT
QMAAYAIHFMGLDGSGTTTGNTVTVTSPGNQSATVGTAISAVQVHATDSATGQSLTYSAT
GLPAGLSISSSGLISGTPTAAGTSTSTVTATDGTGASGSATFTWTVSGGGGTTPGTCHVA
YTRTNEWPGGFTANVTITNTGTAAINGWTVGWSFPGDQKITNAWSATATQSGAAVSAANV
AYDATIAPGANTSFGFQGTFTANDTSPSSFTVNGAACS


>Caci_3591 esterase, PHB depolymerase family
ATGCTGCGATCCCGTTCTGTGAAAACCCGCCTGCTCGGTCTGTTCGCGGCAGTGGCGGCT
GCTGTCGCTGTGAGTTTGCCTGCCGCGCCGCAGGCTGCTGCCGCGTCGTTGACGCAGGTG
ACGAACTTCGGGACCAACCCGAGCAACCTGGCGATGTATGTGTATGTGCCGAACAACGTC
AAGCCCAACCCGTCGATCCTGTTGGCGATGCACGGCTGTCAGGGCACTGCGTCGTACATG
TACTCCAGTACTGATTTCGGGAAGCTGGCCGATCAGTACGGGTTCATCGTCATCTACCCG
CAGACCAACCCCAGCGGCAGTTGCTGGGATGTGTCCTCCGATCAGGCGCTGAAACGCAAC
GGCGGCAGCGATCCGGTGGGTCTGATGTCGATGATCACCTACACCGAGCAGCACTACGGC
GGGAATGCCAACTCGGTGTTCGTCACCGGGGAGTCCTCCGGCGGGATGATGACCAACGTC
ATGCTCGCCGACTACCCGGATGTGTTCAAGGCTGGTGCGGCGTTCATGGGCGTGCCCTAC
CACTGCTTCTACACCGGCAGCGTGCGCGGCTGGAACTCGCCCTGCGCCAACGGCCAGGTC
TCCATGACCGCCCAGCAGTGGGGCGACCTCGTGCGCAATGACGGGGATCCCGGTTACACC
GGTCCGCGTCCGCGGATGCAGTTGTGGCATGGCACTGCCGACACCACGTTGAACTACAAC
AATCTGGGTGAGGAGATCAAGCAGTGGACGAACGTGGACGGGGTGAGTCAGACCCCGTCG
TCCAGTGACACCCCGGTCGCCAACTGGAACCGCACCCGCTACAACAACGCCTCCGGCACC
ACCCAGGTCGAGGCGTACAGCATCGTCGGCGCCGGACACCAGCTGCCGATCCAGGGCACA
CAGATGGCCGCCTACGCCATCCACTTCATGGGCCTGGACGGCAGCGGCACCACCACCGGC
AACACGGTCACCGTGACCAGCCCCGGCAACCAGAGCGCCACCGTCGGCACCGCGATCAGC
GCCGTGCAGGTCCACGCCACCGACTCGGCCACCGGACAGTCCCTGACCTACAGCGCGACC
GGTCTTCCGGCGGGGCTGTCGATCTCCTCCAGCGGGCTGATCTCCGGCACTCCGACCGCA
GCCGGCACCTCCACCTCGACGGTGACCGCGACCGACGGGACCGGCGCGTCCGGCTCGGCG
ACGTTCACCTGGACCGTCTCCGGCGGCGGCGGTACCACGCCGGGCACCTGCCATGTCGCC
TACACCAGGACCAACGAATGGCCAGGAGGCTTCACCGCCAACGTCACGATCACCAACACC
GGTACGGCGGCGATCAACGGCTGGACCGTCGGCTGGAGCTTCCCCGGCGACCAGAAGATC
ACCAACGCCTGGAGCGCCACCGCCACCCAGAGCGGCGCCGCCGTCAGTGCCGCCAACGTC
GCCTACGACGCCACCATCGCCCCCGGAGCCAACACCTCGTTCGGCTTCCAGGGCACGTTC
ACCGCGAACGACACCTCACCCTCGAGCTTCACCGTCAACGGAGCCGCGTGCTCATAG


Assigned Rule

Assigned RuleRelated Function
PHAZ2 (NRULE_0080)Poly(3-hydroxyalkanoate) depolymeraseBioplastic degradation (NFUNC_0015)