English site

CDS : Caci_3724

CDS Description

CDSCaci_3724
Product nameAlpha,alpha-trehalose-phosphate synthase (UDP- forming)
Gene name
ContigCP001700
location4192547..4194064
NBRC No.102108
MicrobeCatenulispora acidiphila
Current status
>Caci_3724 Alpha,alpha-trehalose-phosphate synthase (UDP- forming)
VGMTTGRAADFLVVANRLPVDVEQLEDGTQRWRSSPGGLVSALEPFLRDRKGAWVGWSGQ
ADLDVASFDDDGLVMHPVRLSAAEVRDHYEGFSNATLWPLYHDVVVRPVFERAWWDSHVA
VNRRFADAAAAAAAPGATVWVQDYQLQLVPAMLREQRPDLRIGFFLHIPFPPVELFMQLP
WRSEIVRGLLGADVVGFQMPGGAQNFLWLTRKLLGLEPSKAAVHVRSHPGSVPYDGRQVK
VGAFPISIDTAAFDELSRQSRTVERAQQIRTDLGNPRRLLLGVDRLDYTKGIDVRLRALR
ELLVTRQVDPESVAMVQLATPSRERVDQYKAMRRSIEEQVGRLNGEFGRVGRPIVHYLHQ
PVDREELVALYCAADVMVVTPLRDGMNLVCKEYVATRHDLDGALVLSEFAGAAAELTDAF
LVNPHDLNSVAHALERALTMDPTEERSRMRAMHRQVMTHDVSRWAQSFLDFLEPTPMPST
NTTTPALDVTTLIRPTPLTAAATPQ


>Caci_3724 Alpha,alpha-trehalose-phosphate synthase (UDP- forming)
GTGGGGATGACGACAGGGCGTGCCGCGGACTTTCTGGTGGTCGCGAATCGGCTGCCGGTT
GATGTGGAACAACTTGAGGACGGGACTCAACGGTGGCGTTCGAGTCCTGGTGGTCTGGTC
AGTGCGTTGGAGCCGTTTCTGCGCGACCGTAAGGGCGCCTGGGTCGGATGGTCCGGTCAG
GCCGATCTGGATGTGGCATCCTTCGACGACGACGGCTTGGTGATGCATCCGGTGCGCCTG
TCCGCTGCCGAGGTGCGGGACCACTACGAGGGTTTCTCCAACGCCACGCTCTGGCCGCTG
TATCACGATGTCGTGGTGCGGCCGGTGTTCGAGCGGGCTTGGTGGGACAGCCATGTCGCG
GTGAACCGGCGTTTCGCCGATGCCGCTGCCGCCGCGGCGGCGCCGGGGGCGACGGTATGG
GTGCAGGACTACCAGCTCCAACTGGTTCCGGCCATGTTGCGGGAGCAGCGTCCTGATCTA
CGGATCGGGTTCTTCCTGCACATCCCGTTTCCGCCGGTCGAGCTGTTCATGCAGCTGCCA
TGGCGCAGCGAGATCGTCCGGGGACTGCTGGGCGCCGACGTGGTCGGCTTCCAGATGCCA
GGCGGGGCGCAGAACTTCCTGTGGCTGACCCGCAAACTACTGGGCCTGGAACCGTCGAAG
GCGGCGGTGCATGTCCGGAGCCACCCCGGGTCCGTCCCGTACGACGGCCGGCAGGTCAAG
GTCGGAGCCTTCCCGATCTCCATCGATACCGCGGCCTTCGACGAACTCTCCCGGCAGTCC
CGCACTGTCGAGCGTGCCCAGCAGATCCGTACGGACTTGGGGAATCCGCGCCGATTGTTG
TTGGGAGTGGACCGGCTCGATTACACCAAGGGCATCGACGTACGGCTGCGGGCCTTGCGC
GAGCTGCTGGTCACGCGCCAGGTGGACCCGGAGTCGGTGGCCATGGTCCAGCTGGCGACT
CCGAGCCGGGAGCGCGTCGATCAGTACAAGGCGATGCGGCGCAGCATCGAGGAGCAGGTG
GGGCGACTCAACGGCGAGTTCGGCCGGGTCGGCCGCCCGATCGTCCATTACCTGCACCAG
CCGGTGGACCGCGAGGAGCTTGTCGCGCTGTATTGCGCGGCCGACGTCATGGTGGTCACA
CCCCTGCGAGACGGGATGAACCTGGTGTGCAAGGAGTACGTCGCCACCCGGCACGACCTC
GACGGAGCATTGGTGTTGTCCGAGTTCGCGGGAGCGGCGGCCGAGCTGACCGACGCCTTC
CTGGTGAACCCGCACGACCTGAACAGCGTCGCACACGCCCTGGAACGAGCGCTGACCATG
GACCCAACCGAGGAGCGGTCACGGATGCGGGCCATGCACCGCCAGGTGATGACGCACGAC
GTGAGCCGGTGGGCGCAATCCTTCCTCGACTTCCTAGAGCCCACTCCGATGCCGTCGACG
AACACGACGACACCAGCGCTCGACGTGACGACGTTGATCAGGCCGACGCCCTTGACCGCA
GCGGCGACGCCACAGTAG


Assigned Rule

Assigned RuleRelated Function
TPS (NRULE_0119)Trehalose-phosphate synthaseTrehalose biosynthesis (from NDP-glucose and glucose-6-phosphate) (NFUNC_0031)