English site

CDS : Caci_6778

CDS Description

CDSCaci_6778
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP001700
location7824941..7825609
NBRC No.102108
MicrobeCatenulispora acidiphila
Current status
>Caci_6778 NAD(P)H dehydrogenase (quinone)
MATLLRIDASLFPDEASASRSVTSAFTDAWRAAHPDGTVVHRDLAADPLPHLDVLTVSAG
FADPSAHSEAQAAAHAARLALIEEAEAADAIVIGAPMYNFGLASGLKAWLDHVILNGRTS
GEGARSLAGKPVVVVASRGGSYEPGTPREGMEYVKNYLGSVLSEHLGITPEFITIQLTLA
SAVPAMADLIPLAEQSRAEALEQADAKARELAAQLSGEPVAA


>Caci_6778 NAD(P)H dehydrogenase (quinone)
ATGGCCACGTTGCTGCGCATCGACGCCTCGCTGTTCCCCGATGAGGCCAGCGCCTCCCGG
TCTGTCACCTCGGCCTTCACCGACGCCTGGCGCGCGGCCCATCCCGACGGCACCGTCGTC
CACCGCGACCTCGCCGCCGACCCGCTGCCGCACCTGGACGTGCTCACCGTCTCCGCCGGC
TTCGCCGACCCGTCCGCGCACAGCGAGGCCCAGGCCGCCGCGCACGCCGCCCGGCTGGCG
CTGATCGAGGAGGCCGAAGCCGCCGACGCGATCGTGATCGGCGCGCCGATGTACAACTTC
GGGCTCGCCTCCGGGCTGAAGGCGTGGCTCGACCACGTCATCCTGAACGGCCGCACCTCC
GGTGAGGGCGCGCGCTCCCTGGCCGGCAAGCCCGTGGTGGTCGTCGCCTCGCGCGGCGGC
TCCTACGAGCCCGGGACGCCGCGCGAGGGCATGGAGTACGTGAAGAACTACCTCGGCAGC
GTCCTGTCCGAGCACCTGGGCATCACGCCGGAGTTCATCACCATCCAGCTCACGCTCGCC
TCGGCCGTCCCGGCGATGGCCGACCTGATCCCGCTGGCCGAGCAGTCGCGCGCCGAAGCG
CTGGAGCAGGCCGACGCCAAGGCCCGCGAGCTCGCGGCGCAGCTGTCAGGGGAGCCGGTC
GCAGCCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)