English site

CDS : CfE428DRAFT_0360

CDS Description

CDSCfE428DRAFT_0360
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigABVL01000001
location413909..414565
NBRC No.Not assigned
MicrobeChthoniobacter flavus
Current status
>CfE428DRAFT_0360 NAD(P)H dehydrogenase (quinone)
MTSRPTLLHIDSSPRRAMSISRQLTAEYVTQWKRANPEGAIRRRDLSGSDLPLLTGEWIN
ASFTPEVSRTAEQRELLRISDTLVAELQAADEYVIGVPMHNFTIAASLRLWIDQIVRVGE
TFAYVDGLPTGLLKNKRATFVISTGGVYQPGTSLAACDFVEPYLRAIFGFMGVADLHAFT
ASGAAAVTSGRMDAATFLRPHFESIRQHFVPMATASAS


>CfE428DRAFT_0360 NAD(P)H dehydrogenase (quinone)
ATGACCTCGCGCCCCACCCTGCTGCACATCGACTCCAGCCCGCGCCGCGCGATGTCGATT
TCCCGGCAACTGACCGCCGAATACGTCACCCAGTGGAAGCGGGCCAATCCCGAGGGAGCG
ATCCGGCGGCGCGATCTGTCCGGCAGCGATCTTCCGCTCCTCACCGGCGAATGGATCAAC
GCATCCTTCACGCCAGAAGTATCCCGCACGGCGGAGCAACGCGAGTTACTCCGTATTTCG
GATACGCTCGTCGCGGAGCTGCAAGCGGCCGACGAATATGTGATCGGCGTACCGATGCAT
AATTTCACCATCGCAGCGAGCCTCCGGCTGTGGATCGACCAGATCGTGCGCGTGGGCGAG
ACCTTCGCCTACGTCGATGGTCTCCCCACCGGCTTGCTGAAAAACAAACGCGCCACCTTC
GTGATCTCCACCGGCGGCGTGTATCAGCCCGGCACGTCCCTGGCGGCGTGCGATTTTGTC
GAACCCTACCTGCGCGCGATCTTCGGTTTCATGGGGGTCGCTGACCTTCACGCCTTCACC
GCGAGTGGCGCTGCCGCCGTCACCTCCGGCAGAATGGATGCAGCGACCTTCCTGCGACCG
CACTTCGAATCGATCCGACAACATTTCGTGCCCATGGCTACAGCCAGCGCGAGTTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)