English site

CDS : Cpin_1692

CDS Description

CDSCpin_1692
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP001699
location2037329..2037931
NBRC No.15968
MicrobeChitinophaga pinensis
Current status
>Cpin_1692 NAD(P)H dehydrogenase (quinone)
MKKILKVVSSVSGAASKSTQLADGIIAQLQERYPGSTVTVKDLAKDPLGHFDASHLLAFR
GAGDATAEAAAIADKLSEAAIKEVEEADIIILGVALYNFHIPSTLKAWLDHVVRAGRTFS
YATGKPEGLLKDKKVYIALASGGVYSEGPAQAFDFASPYLLGMLGFIGLTDVQLVRAEGC
SIPGLQDTAVQKGLEQVVIA


>Cpin_1692 NAD(P)H dehydrogenase (quinone)
ATGAAAAAGATATTGAAAGTTGTATCCAGTGTGAGTGGCGCTGCGTCAAAGAGTACACAG
CTGGCAGATGGAATTATTGCTCAGTTACAGGAACGTTATCCGGGCAGCACAGTGACTGTA
AAAGATCTTGCAAAAGATCCTTTAGGTCATTTTGATGCATCTCACCTGTTGGCATTCCGT
GGCGCAGGAGATGCGACAGCAGAAGCAGCAGCGATTGCTGATAAGTTATCAGAAGCGGCT
ATTAAGGAGGTGGAAGAAGCGGATATCATCATTTTGGGAGTAGCGCTGTATAATTTCCAT
ATTCCGTCTACGCTGAAAGCGTGGCTGGATCACGTCGTACGTGCCGGCAGAACTTTCTCT
TATGCCACCGGTAAACCGGAAGGTCTGTTAAAGGATAAAAAAGTATATATCGCGCTGGCT
TCAGGTGGTGTTTACTCCGAAGGACCTGCACAGGCATTTGATTTTGCTTCTCCATATCTC
CTGGGTATGCTGGGCTTCATTGGTCTGACAGACGTACAGCTGGTGAGAGCAGAAGGTTGC
AGCATTCCTGGTTTACAGGATACAGCAGTACAGAAAGGATTGGAGCAGGTTGTTATTGCA
TAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)