English site

CDS : Cpin_2707

CDS Description

CDSCpin_2707
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP001699
location3310173..3310775
NBRC No.15968
MicrobeChitinophaga pinensis
Current status
>Cpin_2707 NAD(P)H dehydrogenase (quinone)
MKRILHLISSIQGNESYSYKLSNAIVNKVIEKYPGSTVEEVNLNNLDIPHLTPLILQSMF
TPADQLTPEAKASIRYSDEAVKQLMATDILVIGAPLYNLTIPTTLKAWGDHITRAGITFG
YSENGPVGMVKGKKVYIAMSSGGVYSEGPSKPNDFVAPYLKSFLGLLGMTDVTVFRVEGV
KLPGIKEHALEKGIASIHID


>Cpin_2707 NAD(P)H dehydrogenase (quinone)
ATGAAACGTATCCTTCATCTGATTTCGAGTATTCAGGGCAATGAATCTTACAGTTATAAA
CTCAGCAATGCAATTGTGAATAAGGTTATCGAAAAGTACCCCGGCAGTACAGTCGAAGAA
GTCAACCTGAACAACCTGGACATCCCGCATCTGACGCCATTGATCCTTCAGTCGATGTTT
ACACCGGCTGATCAGTTGACACCAGAAGCCAAAGCGTCAATACGCTATTCGGACGAGGCA
GTGAAACAATTAATGGCAACCGATATCCTCGTCATCGGTGCACCACTCTATAATCTGACG
ATTCCTACTACCTTAAAAGCATGGGGCGATCATATTACCAGGGCTGGCATTACCTTCGGT
TATAGCGAAAATGGACCGGTTGGAATGGTCAAAGGTAAAAAAGTGTATATAGCGATGTCT
TCCGGGGGTGTTTATTCCGAAGGCCCTTCTAAACCTAATGATTTCGTTGCGCCTTATCTG
AAAAGCTTCCTGGGACTTTTAGGGATGACTGACGTGACCGTTTTCCGGGTAGAAGGTGTC
AAACTTCCAGGGATTAAAGAACATGCTCTGGAAAAAGGCATTGCGAGCATCCACATTGAT
TGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)