English site

CDS : Cpin_2757

CDS Description

CDSCpin_2757
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP001699
location3383041..3383658
NBRC No.15968
MicrobeChitinophaga pinensis
Current status
>Cpin_2757 NAD(P)H dehydrogenase (quinone)
MNKVLIINASARKERSLSRYMTNVFVETWQTKYPDDAIVYREVGQESIPHVTETWIAGAF
KPAALRTAAHLEALKISDQLIAELKEANVIVVGSPMYNWSVPSALKAYIDQVLRVNETVL
VSKDNPENPYTGLLKEKKVYLLMVRGNDGYGSGEYYEHMDFQSNYLRTVFTIMGLEDISA
VTMDGVDMGAKLLDVAAEKVKRLIV


>Cpin_2757 NAD(P)H dehydrogenase (quinone)
ATGAATAAAGTATTAATAATAAACGCGAGCGCCCGTAAGGAACGGTCATTAAGCAGGTAT
ATGACCAATGTATTTGTCGAAACCTGGCAAACAAAATATCCGGATGATGCTATTGTTTAC
AGGGAAGTCGGACAGGAGTCTATTCCACATGTAACAGAAACATGGATAGCCGGGGCTTTT
AAACCAGCTGCATTACGAACCGCAGCACATTTAGAAGCGCTTAAAATAAGCGATCAGCTG
ATTGCCGAACTAAAAGAAGCAAATGTCATTGTTGTGGGTTCACCCATGTACAACTGGTCC
GTACCCAGCGCACTGAAAGCATATATTGACCAGGTGCTGCGAGTAAACGAGACGGTCTTA
GTCAGTAAGGATAATCCTGAAAACCCCTATACAGGATTATTGAAAGAGAAAAAGGTGTAC
TTGCTGATGGTGCGCGGTAACGACGGCTATGGTTCAGGGGAATATTATGAGCACATGGAT
TTCCAAAGTAACTATCTGAGGACAGTGTTCACTATTATGGGACTTGAAGACATATCAGCC
GTCACAATGGATGGTGTAGATATGGGTGCAAAACTACTGGATGTCGCCGCAGAAAAGGTG
AAGAGACTAATAGTGTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)