English site

CDS : D187_002831

CDS Description

CDSD187_002831
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigANAH02000017
location21272..21934
NBRC No.100088
MicrobeCystobacter fuscus
Current status
>D187_002831 FMN-dependent NADH-azoreductase
MAELLHIDSSARPGGSDVTRHGSHTRRLTARFVARWRATRPRDGVIYRDVGLNPPTPVTG
RWIHSAFKKPASREPWMRETLAESDVLVDELLAAEVIVAGVPMYNFGVPAQFKAYIDNIV
RVGRTFGFDRTRQGDPYWPLLAEANKTLVVLSSRGDFGYGKGQRLEHMNHVEPSIRSAFG
YIGITRSDSFSGLGRHARLLPTCLGGARAFFRPVDVELAA


>D187_002831 FMN-dependent NADH-azoreductase
ATGGCCGAGCTGCTGCATATCGATTCGAGTGCCCGTCCAGGCGGGTCCGACGTCACCCGT
CATGGCTCTCATACCCGCCGTCTGACGGCCCGGTTCGTGGCGCGCTGGCGTGCCACCCGC
CCACGGGATGGAGTCATCTACCGGGATGTCGGGTTGAATCCGCCCACGCCGGTGACGGGC
CGGTGGATCCACTCCGCCTTCAAGAAGCCGGCATCGCGCGAGCCCTGGATGCGCGAGACG
CTCGCGGAGAGCGATGTGTTGGTGGACGAGTTGCTCGCCGCGGAGGTGATCGTCGCCGGC
GTACCGATGTACAACTTCGGTGTCCCCGCGCAATTCAAGGCCTATATCGACAACATCGTC
CGTGTGGGTCGCACGTTCGGCTTCGACCGCACACGGCAGGGTGACCCCTACTGGCCCCTG
CTCGCGGAGGCAAACAAGACGCTCGTGGTGCTGAGTTCACGCGGCGATTTCGGTTATGGA
AAGGGACAGCGACTCGAGCACATGAACCACGTGGAGCCGAGCATCCGGAGCGCCTTTGGA
TATATTGGCATCACCCGGTCTGACAGCTTCTCCGGCCTGGGGCGCCACGCTCGCCTTCTC
CCCACCTGCTTGGGGGGAGCCCGAGCGTTCTTTCGGCCCGTGGATGTGGAGCTTGCAGCC
TGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)