English site

CDS : EB105725_21_00430

CDS Description

CDSEB105725_21_00430
Product nameFMN-dependent NADH-azoreductase
Gene nameazoR
ContigEB10572521
location43797..44402
NBRC No.105725
MicrobeShimwellia blattae
Current statusHigh-Quality Draft
>EB105725_21_00430 FMN-dependent NADH-azoreductase
MSNVLILKSSINGQASLSNQLIDEYIRMREQAGHRDTITEHDLTRTELPKLDQALFAALR
GAEDPRPGIRQGVALSDTLIDELKRSDLLVIGAPMYNLNVPTDLKKWFDLVARARETFRY
TETYPQGLVDGVRAVVISPRGGIHEGQPTDAVTPYLRAVLGLMGINDVDFIYAEGMDIRP
LGRETGIARARQHMAQAAQLA


>EB105725_21_00430 FMN-dependent NADH-azoreductase
ATGAGCAATGTGCTGATTCTGAAATCAAGTATTAATGGCCAGGCATCGCTGAGTAATCAG
CTGATCGACGAATACATACGGATGCGTGAGCAGGCCGGCCATCGCGACACCATTACCGAG
CACGATCTGACGCGCACAGAACTGCCAAAACTCGACCAGGCGCTGTTTGCCGCCCTGCGC
GGGGCAGAGGATCCGCGCCCCGGGATCCGCCAGGGGGTGGCGCTGTCAGACACACTTATT
GACGAGCTGAAACGCAGTGATCTGCTGGTGATTGGCGCGCCGATGTACAATCTCAACGTG
CCGACGGATCTGAAAAAATGGTTTGATCTGGTGGCCCGGGCACGGGAAACCTTCCGCTAC
ACGGAAACCTACCCGCAGGGGCTGGTTGACGGGGTCCGGGCGGTGGTGATAAGCCCGCGC
GGCGGGATACATGAAGGCCAGCCCACCGATGCGGTAACACCGTATTTGCGCGCGGTTCTC
GGGTTAATGGGGATCAATGATGTGGATTTTATCTATGCCGAAGGCATGGACATCAGACCC
CTGGGGCGCGAAACCGGTATTGCCCGTGCCCGGCAGCATATGGCGCAGGCGGCGCAACTG
GCCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)