English site

CDS : EB105725_21_00570

CDS Description

CDSEB105725_21_00570
Product nameFMN-dependent NADH-azoreductase
Gene nameazoR
ContigEB10572521
location59405..60010
NBRC No.105725
MicrobeShimwellia blattae
Current statusHigh-Quality Draft
>EB105725_21_00570 FMN-dependent NADH-azoreductase
MSKVLVLKSSILAEHSQSGQLADYFVQQWREKHSADQITVRDLAAQPVPVLDGELVGALR
PSDAPLSQRQQEALALSDALIEELNAHDTIVIAAPMYNFNIPTQLKNYFDLIARAGVTFR
YTENGPEGLITGKRTIILTTRGGMYKNTPKDMVSPYLNVFLGFIGLTSPEIIFAEGIAYG
PEAAANAQAEAKAAIDAVVAA


>EB105725_21_00570 FMN-dependent NADH-azoreductase
ATGAGCAAAGTACTTGTTCTTAAATCCAGCATCCTGGCAGAACATTCTCAGTCTGGTCAG
CTGGCCGATTATTTTGTGCAACAGTGGCGTGAAAAACACAGCGCCGATCAGATAACCGTG
CGCGATTTAGCCGCCCAGCCGGTCCCGGTACTGGATGGGGAGCTGGTGGGTGCTCTGCGG
CCTTCCGATGCGCCCCTGAGCCAGCGCCAGCAGGAAGCACTGGCCCTGTCCGATGCGCTG
ATTGAAGAACTCAACGCGCACGATACCATCGTGATTGCCGCCCCGATGTATAACTTCAAC
ATTCCGACTCAGCTGAAAAACTACTTCGATCTGATTGCCCGCGCCGGTGTCACCTTCCGC
TACACCGAAAACGGCCCGGAAGGCTTAATCACCGGGAAACGTACTATCATCCTGACCACC
CGCGGCGGGATGTATAAAAATACCCCGAAAGATATGGTGTCCCCGTATCTGAACGTGTTC
CTGGGCTTTATTGGCCTGACCAGTCCGGAAATCATCTTTGCCGAAGGTATCGCCTATGGC
CCGGAAGCAGCAGCTAACGCCCAGGCGGAAGCCAAAGCTGCTATTGATGCGGTGGTTGCG
GCCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)