English site

CDS : EB105725_26_00280

CDS Description

CDSEB105725_26_00280
Product nameFMN-dependent NADH-azoreductase
Gene nameazoR
ContigEB10572526
location25968..26642
NBRC No.105725
MicrobeShimwellia blattae
Current statusHigh-Quality Draft
>EB105725_26_00280 FMN-dependent NADH-azoreductase
MASVLVLKSSILGSASQSNLLTDFLVEQWKTHHPQDKLTVRDLAKDPLPVLDSEVLGAFG
DTAGLSDRQRGIRERSDALIAELKSHDTLVIAAPMYNFNIPTQLKNYFDLIARAGETFRY
TSAGPEGLVTGKKAIVISSRGGMHAGGASDIVTPYLEQFLGFIGITGVEFVLAEGMAMGE
QAATARDNARAALAALAGTQAAVASAQPEQSRGFLQQLMARLFG


>EB105725_26_00280 FMN-dependent NADH-azoreductase
ATGGCCAGCGTATTAGTATTGAAATCCAGTATTCTTGGTAGTGCTTCTCAGTCAAATTTG
CTGACAGATTTTCTGGTAGAACAGTGGAAAACCCACCACCCGCAGGACAAGCTGACAGTG
CGTGATCTGGCAAAAGATCCCTTACCGGTACTGGACAGCGAAGTGCTCGGGGCATTTGGT
GATACCGCCGGGCTGAGCGACCGCCAGCGAGGCATCCGCGAGCGTTCCGACGCGCTGATT
GCTGAGCTGAAATCTCACGATACCCTCGTGATTGCCGCACCGATGTATAACTTTAATATC
CCGACCCAGCTGAAAAACTATTTTGACCTGATAGCCCGCGCCGGTGAAACGTTCCGCTAC
ACCTCCGCCGGGCCAGAAGGGCTGGTCACCGGTAAAAAAGCGATTGTTATCAGCAGCCGT
GGCGGTATGCATGCCGGTGGCGCCAGCGATATCGTGACCCCGTATCTGGAACAGTTCCTC
GGGTTTATCGGTATTACCGGGGTGGAATTTGTCCTGGCTGAAGGGATGGCGATGGGCGAG
CAGGCCGCGACGGCACGGGATAACGCCCGGGCAGCCTTAGCAGCCCTGGCCGGTACACAA
GCCGCCGTTGCCAGCGCCCAGCCGGAACAGTCCCGGGGATTTTTGCAACAGCTGATGGCC
AGACTGTTTGGCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)