English site

CDS : ECL_02091

CDS Description

CDSECL_02091
Product nameazoreductase
Gene name
ContigCP001918
location2146789..2147394
NBRC No.13535
MicrobeEnterobacter cloacae subsp. cloacae
Current status
>ECL_02091 azoreductase
MSKVLVLKSSILAGYSQSGQLSDYFVEQWREHHSADQITVRDLAANPIPVLDGELVGALR
PSDAPLSPRQQEALALSDELIAELQAHDVIVINAPMYNFNIPTQLKNYFDLVARAGVTFR
YTENGPEGLVKGKRAIVLTSRGGIHKDTPTDLVAPYMSLFLGFIGITDVNFVFAEGIAYG
PEVATKAQTDAKAAIDSLVAA


>ECL_02091 azoreductase
ATGAGCAAAGTATTAGTTTTGAAATCCAGTATTCTGGCAGGGTACTCTCAGTCTGGTCAG
CTGTCTGATTACTTCGTTGAACAGTGGCGTGAACACCATTCCGCAGACCAAATCACCGTG
CGTGACCTAGCTGCAAACCCAATTCCTGTGCTGGATGGCGAGTTGGTTGGCGCGCTGCGT
CCAAGCGATGCACCGCTGAGCCCACGCCAGCAGGAAGCCCTGGCGCTCTCTGATGAGCTG
ATTGCTGAACTGCAGGCGCACGACGTTATCGTGATCAACGCCCCAATGTACAACTTCAAC
ATCCCAACCCAGCTGAAGAACTACTTCGACCTGGTGGCTCGCGCTGGTGTTACCTTCCGT
TACACCGAAAATGGCCCGGAAGGTCTGGTGAAAGGCAAGCGTGCCATCGTGCTGACCAGC
CGTGGCGGTATTCATAAAGATACCCCAACCGACCTGGTTGCGCCGTACATGAGCCTGTTC
CTGGGCTTCATCGGGATCACCGACGTGAACTTCGTGTTTGCAGAAGGTATCGCTTACGGT
CCTGAAGTGGCGACCAAAGCACAGACCGACGCGAAAGCCGCGATCGACAGCCTGGTGGCT
GCCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)