English site

CDS : EFER_1589

CDS Description

CDSEFER_1589
Product nameNADH-azoreductase, FMN-dependent
Gene name
ContigCU928158
location1632179..1632784
NBRC No.102419
MicrobeEscherichia fergusonii
Current status
>EFER_1589 NADH-azoreductase, FMN-dependent
MSKVLVLKSSILAGYSQSNQLSDYFVEQWREMHSADEITVRDLAANPIPVLDGELVGALR
PSDAPLTPRQQEALALSDELIAELKAHDVIVIAAPMYNFNISTQLKNYFDLVARAGVTFR
YTENGPEGLVTGKKAIVITSRGGIHKDGPTDLVTPYLSTFLGFIGISDVKFVFAEGIAYG
PEMAAKAQSDAKAAIDSIVAA


>EFER_1589 NADH-azoreductase, FMN-dependent
ATGAGCAAGGTATTAGTTCTTAAATCCAGCATCCTGGCAGGGTACTCTCAGTCTAATCAG
TTGTCCGATTATTTTGTTGAACAATGGCGCGAAATGCACTCCGCTGATGAAATCACCGTG
CGTGACCTGGCTGCAAATCCGATTCCGGTACTGGATGGCGAACTGGTTGGTGCACTGCGT
CCGAGCGATGCGCCGCTGACTCCGCGTCAACAGGAAGCTCTGGCGCTTTCCGATGAGCTG
ATTGCCGAGCTGAAAGCCCACGACGTTATCGTTATTGCGGCACCGATGTATAACTTCAAC
ATTTCGACTCAGTTGAAAAACTATTTTGACCTGGTGGCACGTGCAGGCGTTACTTTCCGC
TATACCGAGAACGGTCCGGAAGGTCTGGTAACGGGTAAAAAAGCCATCGTTATTACCAGC
CGCGGCGGGATTCATAAAGATGGCCCAACGGATCTGGTAACGCCGTATCTGTCCACATTC
CTGGGCTTTATCGGCATTAGCGATGTGAAATTTGTCTTCGCCGAAGGGATCGCATACGGT
CCGGAAATGGCAGCGAAAGCACAGTCTGACGCGAAAGCAGCCATCGACAGTATTGTTGCT
GCATAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)