English site

CDS : EH105704_12_00760

CDS Description

CDSEH105704_12_00760
Product nameFMN-dependent NADH-azoreductase
Gene nameazoR
ContigEH10570412
location81347..81952
NBRC No.105704
MicrobeEscherichia hermannii
Current statusHIGH_QUALITY_DRAFT
>EH105704_12_00760 FMN-dependent NADH-azoreductase
MSKVLVLKSSILAGYSQSNQLSDYFVDQWREQHSGDEITVRDLAANPIPVLDGELVGALR
PSDAPLTPRQQEALALSDELIAELKAHDVIVIAAPMYNFNIPTQLKNYFDLVARAGVTFR
YTEKGPEGLVTGKRAIVLSSRGGIHKDTPTDLIAPYLRLFLGFIGITDVNFVFAEGIAYG
PEVATKAQADAKAAIDSLVTA


>EH105704_12_00760 FMN-dependent NADH-azoreductase
ATGAGCAAAGTATTAGTTCTTAAATCAAGCATTTTGGCAGGGTATTCACAGTCTAACCAG
TTGTCTGACTATTTTGTTGACCAGTGGCGCGAGCAGCACAGCGGCGATGAGATCACCGTG
CGCGATCTGGCGGCGAACCCGATTCCGGTACTGGACGGTGAACTGGTTGGCGCGCTGCGC
CCGAGCGATGCGCCGCTGACGCCGCGTCAACAGGAGGCGCTGGCGCTGTCTGATGAACTG
ATTGCCGAACTGAAAGCCCATGATGTGATTGTTATTGCGGCCCCGATGTACAATTTCAAC
ATCCCGACGCAGCTGAAAAACTATTTTGACCTGGTTGCCCGTGCCGGCGTGACGTTCCGT
TACACCGAGAAAGGACCGGAAGGTCTGGTGACCGGTAAACGCGCCATTGTGCTGTCCAGC
CGTGGCGGTATTCATAAAGACACCCCGACCGACCTGATCGCGCCGTATCTGCGCCTGTTC
CTGGGCTTTATCGGGATCACCGATGTGAACTTCGTGTTCGCGGAAGGGATTGCCTATGGT
CCGGAAGTCGCGACCAAAGCGCAGGCTGATGCCAAAGCGGCCATCGACAGCCTGGTTACT
GCATAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)