English site

CDS : EcolC_2246

CDS Description

CDSEcolC_2246
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP000946
location2468483..2469088
NBRC No.3972
MicrobeEscherichia coli
Current status
>EcolC_2246 NAD(P)H dehydrogenase (quinone)
MSKVLVLKSSILAGYSQSNQLSDYFVEQWREKHSADEITVRDLAANPIPVLDGELVGALR
PSDAPLTPRQQEALALSDELIAELKAHDVIVIAAPMYNFNISTQLKNYFDLVARAGVTFR
YTENGPEGLVTGKKAIVITSRGGIHKDGPTDLVTPYLSTFLGFIGITDVKFVFAEGIAYG
PEMAAKAQSDAKAAIDSIVSA


>EcolC_2246 NAD(P)H dehydrogenase (quinone)
ATGAGCAAGGTATTAGTTCTTAAATCCAGCATCCTGGCAGGGTACTCTCAGTCTAATCAG
TTGTCCGATTATTTTGTTGAACAATGGCGCGAAAAGCACTCCGCTGATGAAATCACCGTT
CGCGACCTGGCTGCAAATCCGATTCCGGTACTGGATGGCGAACTGGTTGGCGCTCTGCGT
CCGAGCGATGCGCCGCTGACTCCGCGTCAGCAGGAAGCTCTGGCACTTTCCGATGAGTTG
ATTGCCGAGCTGAAAGCCCACGACGTTATCGTTATTGCGGCACCGATGTATAACTTCAAC
ATCTCGACTCAGTTGAAAAACTATTTTGACCTGGTTGCCCGCGCAGGCGTTACTTTCCGC
TATACCGAGAACGGTCCGGAAGGTCTGGTAACGGGTAAAAAAGCCATCGTTATTACCAGC
CGCGGCGGGATCCACAAAGATGGACCAACGGACCTGGTGACGCCGTATCTGTCCACGTTC
CTCGGCTTTATCGGCATTACCGATGTGAAATTTGTCTTCGCCGAAGGGATCGCATACGGT
CCGGAAATGGCAGCGAAAGCACAGTCTGACGCAAAAGCAGCCATCGACAGCATTGTTTCT
GCATAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)