English site

CDS : F801_00695

CDS Description

CDSF801_00695
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigNZ_KB911486
location31226..31831
NBRC No.14858
MicrobeMycoplasma hyorhinis
Current statusImproved High-Quality Draft
>F801_00695 FMN-dependent NADH-azoreductase
MNILVIKASVNEKKGSYSSALNDKFIEFYKEKHPHDTFKFFDLNKEKVGLTPLTGENLKE
FKFWQEADSDK*IDLLKWADKVVFSTSMTNFHYSAPAKNFIDAISVNNKTFVYDKASDSY
SGLLSNVKNVQFLLAQGAPKD*YP*GNLANSLRETFAFLGMHIHNKPIVLAGTKVAPNNQ
LSIAEYLKQFEEEIKQAAENF


>F801_00695 FMN-dependent NADH-azoreductase
ATGAATATTTTAGTTATTAAAGCATCTGTAAATGAAAAAAAGGGTTCTTATTCTTCAGCC
CTTAATGACAAATTTATTGAATTTTATAAAGAAAAACACCCACATGATACTTTTAAATTC
TTTGACTTAAATAAAGAAAAAGTTGGTCTTACTCCTTTAACTGGAGAAAATTTAAAAGAA
TTTAAATTCTGGCAAGAAGCAGACTCAGATAAGTGAATTGACTTACTTAAATGGGCAGAC
AAAGTTGTCTTTTCTACTTCAATGACTAATTTCCACTATTCAGCGCCAGCTAAAAACTTT
ATTGATGCAATATCTGTAAATAATAAAACTTTTGTGTATGATAAAGCATCAGATTCATAT
TCAGGTTTACTTTCAAATGTGAAAAATGTTCAATTTTTACTTGCACAAGGTGCTCCAAAA
GATTGATATCCTTGAGGAAATTTAGCTAATTCACTAAGAGAAACATTTGCATTTTTAGGT
ATGCATATTCATAACAAACCAATTGTTTTAGCAGGTACAAAAGTAGCTCCAAACAATCAA
TTAAGCATTGCTGAGTATTTAAAACAATTTGAAGAAGAAATAAAACAAGCAGCTGAAAAT
TTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)