English site

CDS : Fjoh_3322

CDS Description

CDSFjoh_3322
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP000685
location3969343..3969954
NBRC No.14942
MicrobeFlavobacterium johnsoniae
Current status
>Fjoh_3322 NAD(P)H dehydrogenase (quinone)
MSQKILRIITSTNGDTSFSNQLSNAVIEKLTAGNPETEVKTLDLTKTPLPYLTNSHISAV
YAPEETHTPEQKEALKYSNEAIKTLLESDVIVIGVPLYNFGIPAVLKGWIDQIARAGKTF
SYSAEGPKGLVTDKKVYLSIASGAIFSEGPYKSYDFSESYLRAVFGFLGMTDVTTFRVEG
TAIPDFAENALPKALSSVEEFAF


>Fjoh_3322 NAD(P)H dehydrogenase (quinone)
ATGAGCCAAAAAATTCTACGCATAATTACCAGTACCAATGGTGATACTTCATTTAGTAAT
CAGCTGTCGAATGCTGTTATTGAAAAATTAACTGCAGGAAATCCTGAAACTGAAGTAAAA
ACTCTTGACCTTACTAAAACACCTTTACCATATTTGACTAATTCGCATATAAGTGCTGTA
TATGCTCCTGAGGAAACTCATACTCCGGAACAGAAAGAAGCATTAAAATATTCAAATGAA
GCAATAAAAACTTTATTAGAATCGGATGTAATTGTAATTGGTGTGCCTTTGTACAATTTT
GGTATTCCGGCTGTTTTAAAAGGCTGGATTGATCAGATTGCGAGAGCAGGAAAAACTTTT
AGTTACAGTGCCGAAGGACCAAAAGGATTGGTAACTGATAAAAAAGTGTATTTATCAATT
GCATCTGGTGCTATTTTTTCTGAAGGACCATACAAAAGCTACGATTTTTCAGAATCGTAT
CTTCGAGCGGTATTTGGTTTTTTAGGAATGACGGATGTTACTACTTTTCGTGTAGAAGGA
ACTGCAATTCCTGATTTTGCCGAAAATGCTTTACCAAAAGCCTTATCTTCTGTAGAAGAA
TTTGCTTTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)