English site

CDS : GS4_26_01550

CDS Description

CDSGS4_26_01550
Product nameFMN-dependent NADH-azoreductase
Gene nameazoR
ContigGS426
location149141..149785
NBRC No.108243
MicrobeGordonia soli
Current statusHigh-Quality Draft
>GS4_26_01550 FMN-dependent NADH-azoreductase
VPTLLRIDSSADLANSTSRALTGLFVDTWSARDGERAVIDRDLHAAPPPHLVDPGLHYAP
RLRIDSEQPPTESETVQDELIGEILAADALVIGAPMYNWSIPSTLKAWIDHIHVLGVTAP
FDTPEQPFAGIPVVLISSRGLTYGPGTPDEEDDHTIPPICRVLETALGMPTTVVTADLTL
ANRLAPLASLAAESEKSLERARAEVVDLASSVGP


>GS4_26_01550 FMN-dependent NADH-azoreductase
GTGCCGACCCTGCTGCGGATCGACTCGTCCGCCGATCTCGCGAACTCGACTTCGCGTGCG
CTCACCGGACTGTTCGTCGACACCTGGTCGGCACGCGACGGAGAGCGAGCGGTGATCGAT
CGGGATCTGCATGCTGCGCCGCCGCCCCATCTGGTCGATCCGGGCCTGCACTATGCACCA
CGGCTCCGGATCGACTCGGAGCAGCCGCCGACCGAATCGGAGACCGTGCAAGACGAACTC
ATCGGTGAGATCCTCGCGGCCGACGCGTTGGTGATCGGCGCCCCGATGTACAACTGGTCG
ATCCCGTCGACGCTCAAGGCCTGGATCGATCACATCCACGTGCTCGGTGTCACCGCGCCA
TTCGATACGCCAGAACAGCCCTTCGCGGGAATCCCGGTGGTGCTCATATCGTCTCGCGGA
CTGACCTACGGTCCCGGGACTCCCGACGAAGAGGACGATCACACGATCCCGCCGATCTGT
CGCGTCCTCGAGACCGCCCTCGGTATGCCGACGACCGTGGTCACCGCCGACCTCACACTC
GCGAATCGACTCGCGCCGTTGGCGTCGCTGGCCGCCGAGTCGGAGAAGTCGCTGGAGCGT
GCACGCGCCGAGGTCGTCGATCTGGCTAGTAGCGTCGGACCCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)