English site

CDS : GYU_03_02780

CDS Description

CDSGYU_03_02780
Product nameazoreductase
Gene nameyvaB
ContigAFSI01000003
location273836..274522
NBRC No.15718
MicrobeBacillus mojavensis
Current status
>GYU_03_02780 azoreductase
MTRLNDNNGCVILKLKGLVKMAKVLYITAHPHDEATSYSMATGKAFIESYKEANPNDEVV
HIDLYKENIPHIDADVFSGWGKLQSGDELSENEKAKVGRLGGLSDQFASADKYVFVTPLW
NFSFPPVMKAYLDSVAVAGKSFKYTEQGPVGLLTDKKAIHIQARGGYYSEGPAAEMEMGH
RYIGIMMNFFGVPSFDGIFVEGHNAEPDKAQQIKEDAIARAKEAGKTF


>GYU_03_02780 azoreductase
ATGACGCGTCTGAATGATAATAACGGATGTGTAATTTTAAAATTGAAAGGGCTGGTAAAA
ATGGCAAAAGTATTGTATATCACTGCTCACCCGCATGATGAAGCAACTTCTTACAGCATG
GCAACAGGTAAAGCGTTTATTGAATCATACAAAGAAGCAAATCCAAATGATGAAGTTGTA
CATATCGACTTGTACAAAGAAAACATTCCTCACATTGATGCTGATGTATTCAGCGGCTGG
GGCAAGCTCCAGTCCGGCGATGAACTTTCTGAAAACGAAAAAGCGAAAGTGGGCCGTTTA
GGAGGGCTTAGCGATCAATTTGCATCTGCTGATAAATATGTGTTCGTCACGCCACTATGG
AACTTCTCATTCCCGCCAGTGATGAAAGCATACCTTGATTCAGTTGCAGTAGCAGGAAAG
TCTTTTAAATACACTGAACAAGGTCCAGTCGGCTTGTTAACTGATAAAAAAGCGATTCAC
ATTCAAGCGCGCGGCGGCTATTATTCAGAAGGCCCTGCGGCTGAAATGGAAATGGGCCAC
CGCTACATCGGCATTATGATGAACTTCTTCGGCGTTCCATCCTTCGATGGCATTTTCGTA
GAGGGCCATAATGCAGAGCCTGACAAAGCACAGCAAATCAAAGAAGATGCAATTGCCCGC
GCAAAAGAAGCAGGAAAAACATTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)