English site

CDS : GYU_13_01830

CDS Description

CDSGYU_13_01830
Product nameNADPH-dependent FMN reductase YhdA
Gene nameazr
ContigAFSI01000013
location179419..179943
NBRC No.15718
MicrobeBacillus mojavensis
Current status
>GYU_13_01830 NADPH-dependent FMN reductase YhdA
MNILVMSGSPRKHGRTRVAAAFISSLYHTDLIDLSEFILPLFNGEADQAEVMRVQELKQR
VSEADAIVLLSPEYHSGMSGTLKNALDFLSNEQFKYKPVALLAAAGGGKGGINALNNMRT
VMRGLYANVIPRQLVLDPVTIDVENATVTEHMAVSIKELMEELHMFANTGNPGV


>GYU_13_01830 NADPH-dependent FMN reductase YhdA
ATGAACATATTAGTCATGAGCGGCTCGCCGAGAAAACATGGCAGGACAAGAGTTGCGGCA
GCCTTTATATCATCTCTGTATCACACGGATTTGATTGATTTAAGCGAATTTATATTGCCG
TTATTTAACGGTGAAGCCGACCAGGCTGAAGTTATGCGGGTACAGGAGCTAAAGCAGCGT
GTCAGCGAAGCGGATGCGATTGTATTACTATCTCCTGAATATCACAGCGGCATGAGCGGC
ACTTTAAAAAATGCACTGGATTTTTTAAGCAACGAACAATTCAAATATAAGCCAGTAGCA
CTTTTGGCAGCAGCAGGCGGCGGAAAAGGCGGAATCAATGCGCTGAACAATATGAGAACC
GTGATGCGGGGCTTATATGCCAATGTCATTCCGAGGCAGCTTGTGCTTGATCCGGTAACA
ATTGATGTGGAAAATGCAACAGTAACAGAACACATGGCGGTCAGCATAAAAGAGCTGATG
GAAGAATTGCACATGTTCGCAAATACAGGAAACCCCGGCGTCTAA


Assigned Rule

Assigned RuleRelated Function
AZR (NRULE_0237)NADPH azoreductaseAromatic azo compounds degradation (NFUNC_0073)