English site

CDS : GfraN1_010100007742

CDS Description

CDSGfraN1_010100007742
Product nameACP phosphodieterase
Gene name
ContigNZ_BADZ01000008
location42384..42989
NBRC No.101659
MicrobeGluconobacter frateurii
Current status
>GfraN1_010100007742 ACP phosphodieterase
MKLLHIDSSILGGFSASRQLSIAIVERYRQKHPDLEVTSLDLAAEPLPHLDGESLSFLGK
ELTADAASNPVLVAGAKALADFKATDILVLGVPMYNFGIPSQLKAWIDRIAIAGQTFRYG
ANGVEGLAGGKTVVIAGARGGIYSEGTPQAIFEHQVTYIKAVLGFLGVTDIKVIEAEGLA
TNGGNDRPRILAEAESAIAAL


>GfraN1_010100007742 ACP phosphodieterase
ATGAAACTGCTTCATATCGACTCCAGCATTCTCGGCGGTTTTTCCGCTTCCCGTCAGCTC
AGCATTGCGATTGTTGAGCGTTATCGCCAGAAACATCCGGATCTGGAGGTCACATCCCTT
GATCTGGCTGCAGAACCGCTTCCGCACCTGGATGGCGAATCACTGTCATTTCTGGGGAAA
GAGCTGACAGCCGATGCCGCGTCCAATCCTGTGCTCGTGGCGGGTGCAAAGGCTCTGGCC
GATTTCAAGGCAACCGACATCCTTGTGCTTGGTGTGCCGATGTACAATTTCGGAATTCCC
AGCCAGCTCAAGGCCTGGATCGATCGTATTGCAATCGCCGGTCAGACGTTCCGTTATGGG
GCAAATGGCGTCGAAGGCCTTGCCGGTGGCAAGACGGTCGTGATCGCTGGCGCCCGTGGC
GGCATCTACTCAGAAGGAACGCCACAGGCTATTTTTGAGCATCAGGTGACCTACATCAAG
GCCGTTCTTGGTTTCCTTGGTGTTACGGATATCAAGGTCATCGAGGCTGAAGGCCTTGCT
ACAAATGGTGGCAATGACCGCCCTCGTATCCTTGCGGAAGCAGAGAGCGCCATTGCTGCT
CTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)