English site

CDS : Gobs_1788

CDS Description

CDSGobs_1788
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP001867
location1856712..1857338
NBRC No.13315
MicrobeGeodermatophilus obscurus
Current status
>Gobs_1788 NAD(P)H dehydrogenase (quinone)
MARLLHISSSPRGGDSESLRIAEVFTSAYEETHPGDLVQHWDLWDGSLPDFAVGARAKMS
VFGGHAPAGAEAEAWAAARRVFERFDSADRLLFSVPMWNAGIPYVLKQFIDVVSQPGWVF
GVDPDTGYDHLLAGRRKRVAVVYTSAVWGPHLGPDFGSDFQSTYFTDWLRWTGLTDISDI
RYHPTLTGDRDMARQAADAVARDVAKSF


>Gobs_1788 NAD(P)H dehydrogenase (quinone)
ATGGCCAGGTTGCTGCACATCTCGTCGTCCCCACGAGGAGGGGACTCGGAGTCCCTGCGG
ATCGCAGAGGTGTTCACGAGTGCGTACGAGGAGACGCACCCGGGTGACCTCGTCCAGCAC
TGGGACCTGTGGGACGGGTCGCTGCCGGACTTCGCCGTCGGCGCCAGGGCGAAGATGTCC
GTCTTCGGCGGGCACGCACCGGCGGGGGCCGAGGCCGAGGCGTGGGCGGCGGCCCGGCGG
GTCTTCGAGCGGTTCGACTCGGCGGACCGGCTGCTGTTCAGCGTCCCCATGTGGAACGCC
GGCATCCCCTACGTCCTCAAGCAATTCATCGACGTGGTGAGCCAGCCCGGATGGGTCTTC
GGGGTGGACCCCGACACCGGCTACGACCACCTGCTCGCCGGCCGCCGCAAGCGGGTCGCC
GTCGTCTACACGAGCGCCGTCTGGGGGCCGCACCTCGGCCCGGACTTCGGCAGCGACTTC
CAGTCCACCTACTTCACCGACTGGTTGCGCTGGACCGGCCTCACCGACATCAGCGACATC
CGCTACCACCCGACGCTGACCGGGGACCGGGACATGGCCCGGCAGGCAGCCGACGCCGTC
GCCCGCGACGTCGCGAAGTCCTTCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)