English site

CDS : HBHAL_2558

CDS Description

CDSHBHAL_2558
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigHE717023
location1564437..1565069
NBRC No.102448
MicrobeHalobacillus halophilus
Current status
>HBHAL_2558 FMN-dependent NADH-azoreductase
MNVLVIKANNRPDGISTRMYETFLENIKETDEINVSTYDLFNEDMPYLGQDLFSALGKMQ
EGVTLNDLEQRLMDAKQKAKNAIQEADVIVVAFPLWNFTIPAKLQTFVDYIAEAGFTFRY
TESGPKPLMTDKRVILMNARGGNYSDPSMAPMEMSLTYMRNIFGGLFGMNVKNEVVIEGH
NANPDQAEEIVQEGLEKVAHIASDLSYQNA


>HBHAL_2558 FMN-dependent NADH-azoreductase
ATGAACGTACTTGTCATAAAAGCCAATAACCGTCCAGACGGTATTTCTACCAGGATGTAT
GAAACATTTCTAGAAAATATAAAAGAAACAGATGAGATTAATGTGAGCACGTATGACCTG
TTCAACGAGGACATGCCATACTTGGGTCAAGATTTATTCAGTGCTCTTGGCAAAATGCAA
GAAGGTGTCACTCTGAATGACCTCGAGCAGCGCCTTATGGATGCCAAGCAAAAAGCAAAA
AATGCCATTCAAGAGGCTGATGTAATCGTGGTCGCATTCCCGCTATGGAATTTCACAATT
CCAGCAAAACTACAAACATTCGTCGATTATATTGCGGAAGCTGGCTTCACCTTTAGATAT
ACAGAGAGTGGTCCAAAGCCGCTTATGACGGATAAACGTGTTATCTTGATGAACGCCCGT
GGCGGAAACTATTCAGATCCATCCATGGCACCTATGGAAATGTCCCTCACCTACATGCGT
AATATCTTTGGTGGATTGTTCGGTATGAATGTTAAGAACGAAGTCGTCATCGAAGGTCAC
AATGCCAACCCTGACCAAGCAGAAGAAATTGTACAGGAAGGTCTTGAGAAAGTTGCTCAT
ATCGCTTCTGATTTGTCTTACCAAAACGCTTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)