English site

CDS : HELO_1607

CDS Description

CDSHELO_1607
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigFN869568
location698610..699311
NBRC No.15536
MicrobeHalomonas elongata
Current status
>HELO_1607 NAD(P)H dehydrogenase (quinone)
MTHILHLDASARPGRAGTDEHGSISRRLTHRFATGWTSRHAHDTVTYRDIGAAPPSFIDQ
PWIQSAFTPAAQRSSWMAEVLAESDQMVDELIAADILVIGAPLYNFGMPATLKAWVDQVV
RLGRTVDYDPSQPEDPFIPLLAERPRHAVILSSRGEGGLGPGGPLAHMNHLEPSLTTVLE
FIGITRIHRIAVEHQETGGKLLADSIDAAEHQVDALIAHLAPALHTAEQEEPA


>HELO_1607 NAD(P)H dehydrogenase (quinone)
ATGACTCATATCCTGCACCTCGACGCCAGCGCTCGCCCCGGCCGTGCCGGCACCGACGAA
CACGGCTCCATCAGCCGCCGACTGACGCACCGATTCGCCACCGGCTGGACAAGCCGGCAC
GCGCACGACACCGTCACTTACCGGGATATCGGCGCCGCCCCGCCCTCCTTCATCGACCAG
CCATGGATTCAATCCGCCTTTACTCCAGCGGCGCAACGCTCATCCTGGATGGCGGAGGTG
CTGGCCGAAAGCGACCAGATGGTGGACGAACTGATCGCGGCCGACATCCTGGTCATCGGG
GCTCCGCTCTATAACTTCGGCATGCCGGCAACACTGAAGGCCTGGGTGGATCAGGTCGTG
CGCCTGGGCCGCACGGTGGACTACGACCCGAGCCAGCCGGAAGATCCGTTCATCCCGCTG
CTGGCCGAACGCCCTCGTCACGCCGTCATCCTGTCGTCCCGGGGGGAAGGCGGTCTCGGT
CCAGGCGGCCCCCTGGCCCACATGAATCACCTGGAACCCAGCCTGACCACGGTATTGGAG
TTCATCGGCATCACCCGGATCCACCGGATCGCCGTCGAGCATCAGGAAACCGGAGGAAAA
TTGCTGGCAGACTCCATCGACGCGGCGGAGCATCAGGTGGACGCTTTGATCGCGCACCTC
GCGCCGGCGTTGCACACGGCAGAGCAAGAAGAACCGGCCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)