English site

CDS : HGR_12697

CDS Description

CDSHGR_12697
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigAEGR01000080
location17985..18590
NBRC No.14920
MicrobeHylemonella gracilis
Current status
>HGR_12697 NAD(P)H dehydrogenase (quinone)
MKLLHVDSAITGAHSVSRQLTQAIVAEWKAAKPATTVEYLDLAVNAPGHLDGQVLSGGFK
DEVSERLVSQFLAADVIVVGAPLYNFSIPGQLKAWIDRLSQAGRTFRYTEKGPEGLARGK
TVIVASSRGGFYSNSEMGRALEHQESYLQAVFGFFGITDVRFVRAEGVNMGPEVKAKAIS
DAQASIKPTLAANQAQSKQAA


>HGR_12697 NAD(P)H dehydrogenase (quinone)
ATGAAACTGCTGCATGTCGATTCCGCCATCACCGGCGCTCATTCCGTCTCCCGCCAACTG
ACCCAGGCCATCGTTGCCGAATGGAAGGCCGCCAAGCCCGCCACCACCGTGGAGTACTTG
GACCTGGCCGTGAATGCCCCCGGCCATCTGGACGGGCAGGTGCTCAGCGGTGGCTTCAAG
GACGAGGTCTCTGAACGTCTGGTGAGCCAGTTCCTGGCGGCGGATGTGATCGTTGTGGGT
GCGCCCCTGTACAACTTCTCCATCCCCGGCCAGCTCAAGGCCTGGATCGACCGACTCTCC
CAGGCCGGCCGCACCTTCCGCTATACCGAGAAGGGGCCCGAAGGCTTGGCACGCGGCAAG
ACCGTCATCGTGGCCTCCAGCCGCGGTGGTTTTTATTCGAACAGCGAAATGGGCCGCGCC
CTGGAGCACCAAGAGAGCTACCTGCAGGCCGTGTTCGGCTTCTTCGGCATCACCGATGTG
CGCTTCGTGCGCGCCGAGGGTGTGAACATGGGTCCGGAAGTCAAGGCCAAGGCCATTTCC
GACGCGCAGGCCAGCATCAAGCCGACGCTGGCGGCCAACCAGGCCCAGTCGAAGCAAGCA
GCCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)